Incidental Mutation 'R7149:Nlrp4a'
ID 553999
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms E330028A19Rik, Nalp-eta, Nalp4a
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7149 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26435113-26476142 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26450438 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 490 (V490A)
Ref Sequence ENSEMBL: ENSMUSP00000066841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: V490A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: V490A

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: V490A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: V490A

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: V490A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26444136 splice site probably benign
R9220:Nlrp4a UTSW 7 26450098 missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26459652 missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCATACTACTGGACATTGG -3'
(R):5'- GGTGTCATCGTCCATCTCAAAC -3'

Sequencing Primer
(F):5'- CCATACTACTGGACATTGGAATGC -3'
(R):5'- AAACAGCTTCATGCCATCTATCTG -3'
Posted On 2019-05-15