Incidental Mutation 'R7149:Myl6b'
ID554008
Institutional Source Beutler Lab
Gene Symbol Myl6b
Ensembl Gene ENSMUSG00000039824
Gene Namemyosin, light polypeptide 6B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128494157-128498685 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 128497199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026428] [ENSMUST00000164181] [ENSMUST00000217733] [ENSMUST00000217776] [ENSMUST00000217969] [ENSMUST00000218127] [ENSMUST00000219236] [ENSMUST00000220307] [ENSMUST00000220427]
Predicted Effect probably null
Transcript: ENSMUST00000026428
SMART Domains Protein: ENSMUSP00000026428
Gene: ENSMUSG00000039824

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
EFh 67 95 5.08e-3 SMART
EFh 144 172 6.38e0 SMART
Blast:EFh 179 207 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164181
SMART Domains Protein: ENSMUSP00000128803
Gene: ENSMUSG00000090841

DomainStartEndE-ValueType
EFh 11 39 8.98e-4 SMART
EFh 88 116 3.64e1 SMART
EFh 123 151 6.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217733
Predicted Effect probably benign
Transcript: ENSMUST00000217776
Predicted Effect probably benign
Transcript: ENSMUST00000217969
Predicted Effect probably benign
Transcript: ENSMUST00000218127
Predicted Effect probably benign
Transcript: ENSMUST00000219236
Predicted Effect probably benign
Transcript: ENSMUST00000220307
Predicted Effect probably benign
Transcript: ENSMUST00000220427
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Myl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Myl6b APN 10 128496342 missense possibly damaging 0.54
IGL02257:Myl6b APN 10 128497341 unclassified probably benign
PIT4260001:Myl6b UTSW 10 128496306 missense possibly damaging 0.48
R1971:Myl6b UTSW 10 128494643 missense probably damaging 0.98
R5476:Myl6b UTSW 10 128497347 unclassified probably benign
R6361:Myl6b UTSW 10 128497209 nonsense probably null
R7540:Myl6b UTSW 10 128496280 nonsense probably null
R8221:Myl6b UTSW 10 128497340 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTTCAGAGATGTAGCCTTC -3'
(R):5'- TTTGGCCACCTGACATCATG -3'

Sequencing Primer
(F):5'- CAGAGATGTAGCCTTCTGAGTTGAAC -3'
(R):5'- TCATGCCTCCCAAGAAGGATG -3'
Posted On2019-05-15