Incidental Mutation 'R7149:Cnot6'
ID554009
Institutional Source Beutler Lab
Gene Symbol Cnot6
Ensembl Gene ENSMUSG00000020362
Gene NameCCR4-NOT transcription complex, subunit 6
SynonymsA230103N10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49671503-49712723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49680143 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 341 (P341S)
Ref Sequence ENSEMBL: ENSMUSP00000020624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020624] [ENSMUST00000145353]
Predicted Effect probably benign
Transcript: ENSMUST00000020624
AA Change: P341S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020624
Gene: ENSMUSG00000020362
AA Change: P341S

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 187 526 1.9e-23 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145353
AA Change: P346S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121239
Gene: ENSMUSG00000020362
AA Change: P346S

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 192 531 1.9e-23 PFAM
low complexity region 534 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Cnot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Cnot6 APN 11 49685266 missense probably benign 0.01
IGL00969:Cnot6 APN 11 49685120 missense probably benign
IGL01655:Cnot6 APN 11 49677304 missense probably damaging 1.00
IGL02074:Cnot6 APN 11 49689243 missense probably benign 0.00
IGL02670:Cnot6 APN 11 49685114 nonsense probably null
R0326:Cnot6 UTSW 11 49677436 missense probably damaging 1.00
R0625:Cnot6 UTSW 11 49683171 missense probably damaging 1.00
R1079:Cnot6 UTSW 11 49685103 missense probably benign 0.01
R3820:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3821:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3822:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R4202:Cnot6 UTSW 11 49702636 missense probably damaging 1.00
R4515:Cnot6 UTSW 11 49702536 splice site probably null
R6010:Cnot6 UTSW 11 49683239 nonsense probably null
R6193:Cnot6 UTSW 11 49680023 missense probably benign 0.06
R7501:Cnot6 UTSW 11 49685332 missense probably benign 0.01
R7556:Cnot6 UTSW 11 49675317 missense probably benign 0.15
R8263:Cnot6 UTSW 11 49682175 missense probably damaging 0.99
RF003:Cnot6 UTSW 11 49702613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCTGCACATAACACAAGAGG -3'
(R):5'- GCTTTAGTGCTGGAAGTATCAAAC -3'

Sequencing Primer
(F):5'- TGCACATAACACAAGAGGAATAGTTC -3'
(R):5'- GTGCTGGAAGTATCAAACTAATGTAG -3'
Posted On2019-05-15