Incidental Mutation 'R7149:Olfr397'
ID554012
Institutional Source Beutler Lab
Gene Symbol Olfr397
Ensembl Gene ENSMUSG00000057050
Gene Nameolfactory receptor 397
SynonymsGA_x6K02T2P1NL-4121434-4122381, MOR135-28
Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73960817-73967812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73965431 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 274 (M274I)
Ref Sequence ENSEMBL: ENSMUSP00000150369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121280] [ENSMUST00000213134] [ENSMUST00000216291]
Predicted Effect probably benign
Transcript: ENSMUST00000121280
AA Change: M274I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: M274I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213134
AA Change: M274I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216291
AA Change: M274I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Olfr397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Olfr397 APN 11 73964818 missense probably damaging 1.00
IGL01839:Olfr397 APN 11 73964611 start codon destroyed probably null 1.00
IGL02247:Olfr397 APN 11 73964862 missense probably benign 0.05
IGL02876:Olfr397 APN 11 73964713 missense possibly damaging 0.95
IGL03051:Olfr397 APN 11 73965034 missense probably benign 0.04
IGL03123:Olfr397 APN 11 73964986 missense probably damaging 1.00
IGL03401:Olfr397 APN 11 73965562 utr 3 prime probably benign
3-1:Olfr397 UTSW 11 73964977 missense possibly damaging 0.84
R0496:Olfr397 UTSW 11 73964880 missense probably benign 0.42
R0811:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R0812:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R1503:Olfr397 UTSW 11 73964568 utr 5 prime probably null
R2067:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R2111:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R4912:Olfr397 UTSW 11 73965340 missense probably damaging 1.00
R5240:Olfr397 UTSW 11 73964806 missense probably damaging 1.00
R5656:Olfr397 UTSW 11 73964710 missense probably damaging 0.99
R5801:Olfr397 UTSW 11 73964946 missense probably benign 0.39
R6329:Olfr397 UTSW 11 73964742 missense possibly damaging 0.73
R6720:Olfr397 UTSW 11 73965465 missense probably damaging 1.00
R7283:Olfr397 UTSW 11 73964808 missense probably damaging 1.00
R8194:Olfr397 UTSW 11 73965414 missense probably benign 0.00
Z1176:Olfr397 UTSW 11 73965297 frame shift probably null
Z1177:Olfr397 UTSW 11 73964760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTTGTCATTATTGTCCCATTC -3'
(R):5'- AAAGCCCCTGCATACCATTTG -3'

Sequencing Primer
(F):5'- GCTGATATTTTCATCCTATGCACG -3'
(R):5'- CCCTGCATACCATTTGAAATTGGG -3'
Posted On2019-05-15