Incidental Mutation 'R7150:Crot'
ID554046
Institutional Source Beutler Lab
Gene Symbol Crot
Ensembl Gene ENSMUSG00000003623
Gene Namecarnitine O-octanoyltransferase
Synonyms1200003H03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8966033-8997324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8987878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000003720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003720]
PDB Structure
Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003720
AA Change: V146A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: V146A

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 20 604 2.3e-167 PFAM
Meta Mutation Damage Score 0.3492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Crot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Crot APN 5 8976072 missense probably damaging 1.00
IGL01013:Crot APN 5 8993575 missense probably benign 0.06
IGL01085:Crot APN 5 8973955 missense probably damaging 1.00
IGL02017:Crot APN 5 8970046 splice site probably benign
IGL02306:Crot APN 5 8968701 missense possibly damaging 0.94
IGL02612:Crot APN 5 8969945 missense probably damaging 1.00
IGL02884:Crot APN 5 8978197 critical splice donor site probably null
IGL03091:Crot APN 5 8966897 missense probably benign
IGL03356:Crot APN 5 8988295 splice site probably benign
ouray UTSW 5 8993504 critical splice donor site probably null
R0383:Crot UTSW 5 8968734 missense probably damaging 1.00
R0396:Crot UTSW 5 8969959 missense probably damaging 1.00
R0502:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0503:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0676:Crot UTSW 5 8993622 utr 5 prime probably benign
R1079:Crot UTSW 5 8993504 critical splice donor site probably null
R1472:Crot UTSW 5 8966941 missense probably damaging 1.00
R1595:Crot UTSW 5 8974186 missense probably benign 0.00
R1757:Crot UTSW 5 8987828 missense probably damaging 1.00
R1828:Crot UTSW 5 8969080 missense probably benign 0.01
R1846:Crot UTSW 5 8988248 missense probably benign 0.36
R2142:Crot UTSW 5 8987780 missense possibly damaging 0.94
R3973:Crot UTSW 5 8977541 missense probably benign
R3974:Crot UTSW 5 8977541 missense probably benign
R3975:Crot UTSW 5 8977541 missense probably benign
R4445:Crot UTSW 5 8973643 missense probably damaging 1.00
R4446:Crot UTSW 5 8973643 missense probably damaging 1.00
R4995:Crot UTSW 5 8974000 missense probably damaging 1.00
R5084:Crot UTSW 5 8969994 missense probably damaging 1.00
R5464:Crot UTSW 5 8983690 splice site probably null
R5673:Crot UTSW 5 8988131 missense probably benign 0.00
R5814:Crot UTSW 5 8973996 missense probably damaging 0.99
R5935:Crot UTSW 5 8974192 missense probably benign
R5951:Crot UTSW 5 8969120 nonsense probably null
R6862:Crot UTSW 5 8989641 missense probably damaging 0.99
R6885:Crot UTSW 5 8973635 missense probably benign 0.00
R6983:Crot UTSW 5 8978280 missense probably benign 0.06
R7228:Crot UTSW 5 8976051 missense probably damaging 1.00
R7361:Crot UTSW 5 8977534 missense probably damaging 1.00
R7662:Crot UTSW 5 8969072 missense probably damaging 1.00
R7747:Crot UTSW 5 8968869 critical splice donor site probably null
R8002:Crot UTSW 5 8993599 missense probably benign 0.36
R8105:Crot UTSW 5 8977505 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTACTCAAATGTCAGTGCTCC -3'
(R):5'- AAGAGTGCCAAGGATCCTGG -3'

Sequencing Primer
(F):5'- CCCCCGACCTGCCAAATATC -3'
(R):5'- GCACGGGTTGGACTGAG -3'
Posted On2019-05-15