Incidental Mutation 'R7150:Vps50'
ID554051
Institutional Source Beutler Lab
Gene Symbol Vps50
Ensembl Gene ENSMUSG00000001376
Gene NameVPS50 EARP/GARPII complex subunit
Synonyms8430415E05Rik, 1700034M03Rik, Ccdc132
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location3498382-3603531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3578854 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 639 (M639K)
Ref Sequence ENSEMBL: ENSMUSP00000001412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001412] [ENSMUST00000164052] [ENSMUST00000170873]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001412
AA Change: M639K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376
AA Change: M639K

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164052
AA Change: M639K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376
AA Change: M639K

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170873
AA Change: M639K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376
AA Change: M639K

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Vps50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Vps50 APN 6 3602670 missense probably benign 0.00
IGL00764:Vps50 APN 6 3532177 nonsense probably null
IGL00844:Vps50 APN 6 3532177 nonsense probably null
IGL00845:Vps50 APN 6 3532177 nonsense probably null
IGL00850:Vps50 APN 6 3532177 nonsense probably null
IGL01417:Vps50 APN 6 3522377 splice site probably benign
IGL01648:Vps50 APN 6 3498545 missense probably benign 0.25
IGL03238:Vps50 APN 6 3594771 missense possibly damaging 0.60
IGL03285:Vps50 APN 6 3555011 missense possibly damaging 0.71
R0309:Vps50 UTSW 6 3536853 missense possibly damaging 0.90
R0513:Vps50 UTSW 6 3520210 missense probably damaging 1.00
R0714:Vps50 UTSW 6 3571105 missense probably benign 0.05
R1066:Vps50 UTSW 6 3533565 missense probably damaging 1.00
R1210:Vps50 UTSW 6 3594884 missense probably damaging 0.99
R1420:Vps50 UTSW 6 3588007 nonsense probably null
R1437:Vps50 UTSW 6 3517852 nonsense probably null
R1451:Vps50 UTSW 6 3565628 missense possibly damaging 0.77
R1470:Vps50 UTSW 6 3517777 splice site probably benign
R1576:Vps50 UTSW 6 3545568 missense possibly damaging 0.60
R1599:Vps50 UTSW 6 3565537 missense probably benign 0.00
R1860:Vps50 UTSW 6 3520279 critical splice donor site probably null
R2055:Vps50 UTSW 6 3522265 missense probably benign 0.01
R2109:Vps50 UTSW 6 3555379 missense probably damaging 0.99
R3408:Vps50 UTSW 6 3600212 missense probably damaging 1.00
R3732:Vps50 UTSW 6 3519243 synonymous silent
R3764:Vps50 UTSW 6 3588063 missense probably damaging 1.00
R3828:Vps50 UTSW 6 3533500 missense probably benign
R4092:Vps50 UTSW 6 3551037 missense probably benign
R4385:Vps50 UTSW 6 3516694 missense probably benign 0.00
R4588:Vps50 UTSW 6 3562306 missense probably damaging 1.00
R4843:Vps50 UTSW 6 3536974 critical splice donor site probably null
R4978:Vps50 UTSW 6 3517808 missense probably benign
R5368:Vps50 UTSW 6 3567739 missense possibly damaging 0.88
R5867:Vps50 UTSW 6 3536965 missense probably damaging 1.00
R6591:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6626:Vps50 UTSW 6 3551101 nonsense probably null
R6691:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6707:Vps50 UTSW 6 3545583 missense probably damaging 1.00
R6751:Vps50 UTSW 6 3600274 missense probably damaging 1.00
R6773:Vps50 UTSW 6 3592560 missense probably benign 0.25
R6867:Vps50 UTSW 6 3517835 missense probably benign 0.16
R6883:Vps50 UTSW 6 3498513 unclassified probably benign
R6963:Vps50 UTSW 6 3592577 critical splice donor site probably null
R7147:Vps50 UTSW 6 3567750 nonsense probably null
R7167:Vps50 UTSW 6 3600256 missense probably damaging 1.00
R7235:Vps50 UTSW 6 3588078 missense probably benign 0.01
R7385:Vps50 UTSW 6 3602708 missense probably benign 0.00
R7662:Vps50 UTSW 6 3562304 missense probably damaging 1.00
R7782:Vps50 UTSW 6 3532202 critical splice donor site probably null
X0025:Vps50 UTSW 6 3571012 missense probably benign 0.02
X0062:Vps50 UTSW 6 3594833 missense probably benign
Z1176:Vps50 UTSW 6 3578792 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3555367 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3562312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATATAATGCGCAATGCC -3'
(R):5'- CAACATACTCAGCCAGATGTCTG -3'

Sequencing Primer
(F):5'- ATGCGCAATGCCATATTTCAC -3'
(R):5'- CAGCCAGATGTCTGATGATAATTTCC -3'
Posted On2019-05-15