Incidental Mutation 'R7150:5430401F13Rik'
ID 554053
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene Name RIKEN cDNA 5430401F13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7150 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 131486400-131553763 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131552667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
AlphaFold E9Q328
Predicted Effect probably benign
Transcript: ENSMUST00000075020
AA Change: S75P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113
AA Change: S75P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161385
AA Change: S75P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113
AA Change: S75P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131552592 missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131552779 missense unknown
R1674:5430401F13Rik UTSW 6 131552803 missense unknown
R6374:5430401F13Rik UTSW 6 131552929 missense unknown
R6671:5430401F13Rik UTSW 6 131551350 critical splice donor site probably null
RF005:5430401F13Rik UTSW 6 131552884 small insertion probably benign
RF014:5430401F13Rik UTSW 6 131552857 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552856 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552859 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552861 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552855 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552878 small insertion probably benign
RF029:5430401F13Rik UTSW 6 131552895 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552888 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552873 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552892 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552894 small insertion probably benign
RF042:5430401F13Rik UTSW 6 131552886 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552901 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552883 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552884 small insertion probably benign
X0062:5430401F13Rik UTSW 6 131552638 missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131552721 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAAGCAAGATCCCTTTGTCACT -3'
(R):5'- ACGCTTTGTTTTCTGGCCAC -3'

Sequencing Primer
(F):5'- TCTTGCATATATTGGACCTAGTCAC -3'
(R):5'- TGTTCTTGCTGGCCACC -3'
Posted On 2019-05-15