Incidental Mutation 'R7150:Dpy19l3'
ID554057
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35708630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 450 (D450E)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
Predicted Effect probably benign
Transcript: ENSMUST00000051377
AA Change: D450E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: D450E

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCAGGAGCAGAAACATC -3'
(R):5'- TTACAGTCGTTGCTCACTGC -3'

Sequencing Primer
(F):5'- ACATCAAAGGCGGCTGTC -3'
(R):5'- CCGAGGCAGTGGAGTTTATATTAC -3'
Posted On2019-05-15