Incidental Mutation 'R7150:Polr2m'
ID554068
Institutional Source Beutler Lab
Gene Symbol Polr2m
Ensembl Gene ENSMUSG00000032199
Gene Namepolymerase (RNA) II (DNA directed) polypeptide M
SynonymsD9Wsu138e, Grinl1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71478437-71485935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71483344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 192 (I192N)
Ref Sequence ENSEMBL: ENSMUSP00000034720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034720] [ENSMUST00000163972] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166843] [ENSMUST00000169804]
Predicted Effect probably damaging
Transcript: ENSMUST00000034720
AA Change: I192N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034720
Gene: ENSMUSG00000032199
AA Change: I192N

DomainStartEndE-ValueType
Pfam:GCOM2 28 239 2.1e-79 PFAM
coiled coil region 299 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163972
AA Change: I88N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132335
Gene: ENSMUSG00000032199
AA Change: I88N

DomainStartEndE-ValueType
Pfam:GCOM2 1 142 1.6e-27 PFAM
coiled coil region 195 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163998
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166843
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169804
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a specific form of RNA polymerase II termed Pol II(G). The encoded protein may act as a negative regulator of transcriptional activation by the Mediator complex. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 4. Readthrough transcription between this gene and the neighboring upstream gene MYZAP (myocardial zonula adherens protein) is represented with GeneID 145781. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Polr2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02810:Polr2m APN 9 71483566 missense probably benign 0.42
IGL02956:Polr2m APN 9 71483629 missense possibly damaging 0.88
R1604:Polr2m UTSW 9 71483677 missense probably damaging 1.00
R4828:Polr2m UTSW 9 71483768 missense possibly damaging 0.65
R5748:Polr2m UTSW 9 71483636 missense probably benign 0.02
R5990:Polr2m UTSW 9 71479320 unclassified probably null
R6042:Polr2m UTSW 9 71483798 missense probably damaging 0.98
R6476:Polr2m UTSW 9 71483470 missense probably benign 0.02
R6579:Polr2m UTSW 9 71485720 missense probably damaging 1.00
R7150:Polr2m UTSW 9 71483533 missense probably benign 0.00
R7631:Polr2m UTSW 9 71483475 nonsense probably null
X0067:Polr2m UTSW 9 71479460 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGGTGACACTTACACATTGG -3'
(R):5'- ACAAGGCCCAGAGTTCTGAC -3'

Sequencing Primer
(F):5'- CATTGGTCTTAAACTTATGAGGAGG -3'
(R):5'- CAGAGTTCTGACCTGATGCTTGATAC -3'
Posted On2019-05-15