Incidental Mutation 'R7150:Mto1'
ID554070
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Namemitochondrial tRNA translation optimization 1
Synonyms5730419A02Rik, 2310039H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78448208-78475348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78457283 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 299 (H299R)
Ref Sequence ENSEMBL: ENSMUSP00000034896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000148238]
Predicted Effect probably damaging
Transcript: ENSMUST00000034896
AA Change: H299R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: H299R

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78461643 missense probably benign 0.00
IGL01362:Mto1 APN 9 78452774 missense probably benign 0.00
IGL01906:Mto1 APN 9 78464931 missense probably benign
IGL02499:Mto1 APN 9 78461512 splice site probably benign
IGL02504:Mto1 APN 9 78460927 missense probably damaging 1.00
IGL03104:Mto1 APN 9 78449520 missense probably damaging 1.00
PIT4515001:Mto1 UTSW 9 78457417 missense probably damaging 1.00
R0089:Mto1 UTSW 9 78473872 missense probably benign
R0325:Mto1 UTSW 9 78453004 missense probably damaging 1.00
R0566:Mto1 UTSW 9 78448301 missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78457508 missense probably damaging 1.00
R0659:Mto1 UTSW 9 78470790 missense probably damaging 1.00
R0837:Mto1 UTSW 9 78473790 missense probably damaging 1.00
R1679:Mto1 UTSW 9 78464963 missense probably benign
R1899:Mto1 UTSW 9 78461517 splice site probably benign
R1900:Mto1 UTSW 9 78461517 splice site probably benign
R2235:Mto1 UTSW 9 78457564 missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78458028 missense probably damaging 1.00
R5015:Mto1 UTSW 9 78461621 missense probably benign 0.25
R5420:Mto1 UTSW 9 78452827 missense probably benign
R5947:Mto1 UTSW 9 78461029 missense probably damaging 1.00
R5969:Mto1 UTSW 9 78452905 missense probably damaging 1.00
R6092:Mto1 UTSW 9 78460849 missense possibly damaging 0.95
R6336:Mto1 UTSW 9 78473835 missense probably damaging 0.98
R6542:Mto1 UTSW 9 78457228 missense possibly damaging 0.94
R7092:Mto1 UTSW 9 78470673 missense probably benign 0.25
R7852:Mto1 UTSW 9 78449538 missense possibly damaging 0.82
R7935:Mto1 UTSW 9 78449538 missense possibly damaging 0.82
RF014:Mto1 UTSW 9 78448316 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTAAAGGAGCAATGGCC -3'
(R):5'- TGCAGACGATTTGGAAAACG -3'

Sequencing Primer
(F):5'- GAGCCAGAGTTTAAGGATAGCTTCTC -3'
(R):5'- CGTAAAACCTTTGATTCAATAGAGGG -3'
Posted On2019-05-15