Incidental Mutation 'R7150:Syde1'
ID554074
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Namesynapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms1200008N06Rik, mSYD1A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78584503-78591964 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 78586198 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 566 (Q566*)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218271] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
Predicted Effect probably null
Transcript: ENSMUST00000040580
AA Change: Q566*
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: Q566*

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
Predicted Effect probably benign
Transcript: ENSMUST00000218271
Predicted Effect probably benign
Transcript: ENSMUST00000218875
Predicted Effect probably benign
Transcript: ENSMUST00000218885
Predicted Effect probably benign
Transcript: ENSMUST00000219588
Predicted Effect probably benign
Transcript: ENSMUST00000220430
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78585809 missense probably damaging 1.00
IGL01285:Syde1 APN 10 78588887 missense probably damaging 1.00
IGL01529:Syde1 APN 10 78590181 missense probably benign
IGL01869:Syde1 APN 10 78588919 missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78589371 missense probably damaging 1.00
IGL03187:Syde1 APN 10 78589109 missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78590034 missense probably benign
R0561:Syde1 UTSW 10 78589376 missense probably damaging 1.00
R0605:Syde1 UTSW 10 78589095 unclassified probably benign
R1713:Syde1 UTSW 10 78585696 missense probably damaging 1.00
R1756:Syde1 UTSW 10 78586980 missense probably benign
R4491:Syde1 UTSW 10 78590228 missense probably benign 0.00
R4846:Syde1 UTSW 10 78588897 missense probably damaging 0.99
R5092:Syde1 UTSW 10 78589418 missense probably benign
R5287:Syde1 UTSW 10 78590037 missense probably benign
R5611:Syde1 UTSW 10 78585891 missense probably benign
R5951:Syde1 UTSW 10 78589316 missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78590117 missense probably damaging 1.00
R6169:Syde1 UTSW 10 78586104 missense probably damaging 1.00
R7083:Syde1 UTSW 10 78587069 missense probably benign 0.44
R7239:Syde1 UTSW 10 78588781 missense probably damaging 1.00
R7799:Syde1 UTSW 10 78589907 missense probably benign
Z1176:Syde1 UTSW 10 78586131 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACCCATGATTGGTCAGTAGG -3'
(R):5'- CTTGAACTGAAGTGCCTCCAC -3'

Sequencing Primer
(F):5'- CCATGATTGGTCAGTAGGGAAGC -3'
(R):5'- TATCCTGCAAGTGCCACAAGGG -3'
Posted On2019-05-15