Incidental Mutation 'R7150:Sphk1'
ID554080
Institutional Source Beutler Lab
Gene Symbol Sphk1
Ensembl Gene ENSMUSG00000061878
Gene Namesphingosine kinase 1
Synonyms1110006G24Rik, SK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116530925-116536674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116535081 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 61 (E61D)
Ref Sequence ENSEMBL: ENSMUSP00000131010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000138840] [ENSMUST00000141798] [ENSMUST00000145737] [ENSMUST00000154034] [ENSMUST00000155102]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082152
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
AA Change: E54D

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878
AA Change: E54D

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138840
AA Change: E54D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878
AA Change: E54D

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141798
AA Change: E61D

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878
AA Change: E61D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145737
AA Change: E54D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878
AA Change: E54D

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154034
AA Change: E54D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878
AA Change: E54D

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155102
AA Change: E55D

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878
AA Change: E55D

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are viable, fertile, and without any obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Sphk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0040:Sphk1 UTSW 11 116535065 splice site probably benign
R0565:Sphk1 UTSW 11 116536358 unclassified probably benign
R1307:Sphk1 UTSW 11 116536102 missense probably benign 0.09
R1635:Sphk1 UTSW 11 116535770 missense probably damaging 1.00
R1940:Sphk1 UTSW 11 116535850 missense probably benign 0.00
R4685:Sphk1 UTSW 11 116535280 missense probably damaging 1.00
R5440:Sphk1 UTSW 11 116534888 missense possibly damaging 0.54
R5621:Sphk1 UTSW 11 116536366 unclassified probably benign
R6767:Sphk1 UTSW 11 116536156 missense possibly damaging 0.93
R7207:Sphk1 UTSW 11 116535764 missense probably damaging 1.00
R7758:Sphk1 UTSW 11 116536237 missense possibly damaging 0.75
RF018:Sphk1 UTSW 11 116534945 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTAGTAGAATGCCCTCGAGGAC -3'
(R):5'- ACCTGTTAAATAGGCAGAGTGTC -3'

Sequencing Primer
(F):5'- AATGCCCTCGAGGACTGCTC -3'
(R):5'- GAGTGTCTCAGTCTAGGAAAACCATC -3'
Posted On2019-05-15