Incidental Mutation 'R7150:Gart'
ID554091
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91628463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 638 (Y638C)
Ref Sequence ENSEMBL: ENSMUSP00000023684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000232289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023684
AA Change: Y638C

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: Y638C

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120450
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231380
Predicted Effect possibly damaging
Transcript: ENSMUST00000232289
AA Change: Y638C

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 unclassified probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R7992:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCATGCAGAACACATGG -3'
(R):5'- GCAGAGATGCCCAACATGTAC -3'

Sequencing Primer
(F):5'- CAGAACACATGGGTTCTGTCATGC -3'
(R):5'- ACATGTACCCTCCTGGAGAGTATG -3'
Posted On2019-05-15