Incidental Mutation 'R7150:Ercc3'
ID554093
Institutional Source Beutler Lab
Gene Symbol Ercc3
Ensembl Gene ENSMUSG00000024382
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 3
SynonymsXPB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location32240300-32270151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32257272 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 538 (N538I)
Ref Sequence ENSEMBL: ENSMUSP00000025241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025241]
Predicted Effect probably damaging
Transcript: ENSMUST00000025241
AA Change: N538I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025241
Gene: ENSMUSG00000024382
AA Change: N538I

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:Helicase_C_3 76 203 1.2e-46 PFAM
DEXDc 313 493 2.52e-18 SMART
HELICc 570 648 4.32e-8 SMART
low complexity region 707 716 N/A INTRINSIC
Meta Mutation Damage Score 0.9527 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a frame shift mutation in exon 15 exhibit embryonic lethality prior to E8.5. Mice homozygous for a frame shift mutation following by a stop codon insertion in exon 15 exhibit increased sensitivity to ultraviolet- and gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Ercc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Ercc3 APN 18 32264545 splice site probably benign
IGL01108:Ercc3 APN 18 32264585 missense probably damaging 0.99
IGL01131:Ercc3 APN 18 32269889 makesense probably null
IGL01541:Ercc3 APN 18 32248319 missense possibly damaging 0.87
IGL01959:Ercc3 APN 18 32257358 missense probably damaging 1.00
IGL02862:Ercc3 APN 18 32243202 critical splice donor site probably null
IGL03107:Ercc3 APN 18 32248307 missense possibly damaging 0.95
IGL03334:Ercc3 APN 18 32240837 critical splice donor site probably null
PIT4651001:Ercc3 UTSW 18 32240312 unclassified probably benign
R0545:Ercc3 UTSW 18 32245902 missense probably damaging 1.00
R0561:Ercc3 UTSW 18 32245539 missense possibly damaging 0.85
R1159:Ercc3 UTSW 18 32264558 missense possibly damaging 0.86
R1496:Ercc3 UTSW 18 32261297 splice site probably benign
R1733:Ercc3 UTSW 18 32267165 missense possibly damaging 0.60
R1943:Ercc3 UTSW 18 32246610 missense probably damaging 1.00
R2013:Ercc3 UTSW 18 32248429 missense probably benign
R2015:Ercc3 UTSW 18 32248429 missense probably benign
R2303:Ercc3 UTSW 18 32245547 missense probably benign 0.08
R4393:Ercc3 UTSW 18 32265621 missense probably benign 0.00
R4600:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4601:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4602:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4603:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4796:Ercc3 UTSW 18 32248310 missense probably damaging 1.00
R4957:Ercc3 UTSW 18 32243117 missense probably damaging 1.00
R5253:Ercc3 UTSW 18 32269864 missense probably damaging 0.97
R5265:Ercc3 UTSW 18 32254243 missense probably damaging 0.99
R5342:Ercc3 UTSW 18 32245595 missense probably benign 0.01
R5455:Ercc3 UTSW 18 32267209 missense possibly damaging 0.89
R5639:Ercc3 UTSW 18 32265714 missense probably damaging 0.99
R5702:Ercc3 UTSW 18 32254153 missense probably damaging 0.99
R6026:Ercc3 UTSW 18 32245921 critical splice donor site probably null
R6053:Ercc3 UTSW 18 32246754 missense probably damaging 1.00
R6650:Ercc3 UTSW 18 32261336 missense probably damaging 1.00
R7783:Ercc3 UTSW 18 32248243 missense probably damaging 1.00
Z1177:Ercc3 UTSW 18 32254161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAATTCTGCTAAATGAAAGAGCATC -3'
(R):5'- CACAAGTTCCTGGGACGAG -3'

Sequencing Primer
(F):5'- GAGCATCAAAAGTCCTTAATGCTGTG -3'
(R):5'- GAACAGAGCGCGTTAGATCCC -3'
Posted On2019-05-15