Incidental Mutation 'R7151:Angptl2'
ID554106
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 33243910 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 415 (Q415*)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably null
Transcript: ENSMUST00000004208
AA Change: Q415*
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: Q415*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Acsl1 A G 8: 46,513,597 D202G probably damaging Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dhx57 A T 17: 80,273,047 V492E probably damaging Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Ercc8 T C 13: 108,187,282 probably null Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tiam2 A G 17: 3,448,385 D812G probably benign Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Wdr55 G T 18: 36,762,936 A251S possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
grazie UTSW 2 33243910 nonsense probably null
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
R8719:Angptl2 UTSW 2 33243902 missense possibly damaging 0.74
R8928:Angptl2 UTSW 2 33242304 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CATCGATGGTGAGTACTGGCTG -3'
(R):5'- ATTGTCTGAAGGCAGTAGGC -3'

Sequencing Primer
(F):5'- CTGGAGAACATCTACTGGCTGAC -3'
(R):5'- CAGAAGGAAGGACTTGGTAAAGCTG -3'
Posted On2019-05-15