Incidental Mutation 'R7151:Acsl1'
ID554138
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46513597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000034046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372] [ENSMUST00000135955] [ENSMUST00000211644]
Predicted Effect probably damaging
Transcript: ENSMUST00000034046
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796
AA Change: D202G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110371
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796
AA Change: D202G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110372
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796
AA Change: D202G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135955
SMART Domains Protein: ENSMUSP00000117546
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 78 137 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211644
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Angptl2 C T 2: 33,243,910 Q415* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dhx57 A T 17: 80,273,047 V492E probably damaging Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Ercc8 T C 13: 108,187,282 probably null Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tiam2 A G 17: 3,448,385 D812G probably benign Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Wdr55 G T 18: 36,762,936 A251S possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
R7914:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCCTAGGTATAGGCTTGATTC -3'
(R):5'- CTGGGATGACAGTGGCATTG -3'

Sequencing Primer
(F):5'- CCTAGGTATAGGCTTGATTCGATGAC -3'
(R):5'- CCTTCAGAGACAAGGCCGTATG -3'
Posted On2019-05-15