Incidental Mutation 'R7151:Ercc8'
ID554152
Institutional Source Beutler Lab
Gene Symbol Ercc8
Ensembl Gene ENSMUSG00000021694
Gene Nameexcision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms2810431L23Rik, 4631412O06Rik, B130065P18Rik, 2410022P04Rik, Csa, Ckn1
MMRRC Submission
Accession Numbers

Genbank: NM_028042

Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location108158731-108195364 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108187282 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054835] [ENSMUST00000123657] [ENSMUST00000133957] [ENSMUST00000142931] [ENSMUST00000152634]
Predicted Effect probably null
Transcript: ENSMUST00000054835
SMART Domains Protein: ENSMUSP00000059211
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
WD40 175 215 2.71e-10 SMART
WD40 234 273 9.24e-4 SMART
WD40 323 362 7.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123657
SMART Domains Protein: ENSMUSP00000117492
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133957
SMART Domains Protein: ENSMUSP00000116226
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 54 3e-30 PDB
Blast:WD40 28 54 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142931
SMART Domains Protein: ENSMUSP00000118154
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152634
SMART Domains Protein: ENSMUSP00000122802
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutation of this gene results in skin photosensitivity, increased incidence of skin tumors after UV exposure, and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Acsl1 A G 8: 46,513,597 D202G probably damaging Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Angptl2 C T 2: 33,243,910 Q415* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dhx57 A T 17: 80,273,047 V492E probably damaging Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tiam2 A G 17: 3,448,385 D812G probably benign Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Wdr55 G T 18: 36,762,936 A251S possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Ercc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Ercc8 APN 13 108169459 missense probably damaging 1.00
IGL02074:Ercc8 APN 13 108158784 unclassified probably benign
B5639:Ercc8 UTSW 13 108160723 missense probably damaging 0.96
R0620:Ercc8 UTSW 13 108174061 critical splice donor site probably null
R1909:Ercc8 UTSW 13 108175566 nonsense probably null
R2509:Ercc8 UTSW 13 108183717 splice site probably benign
R2967:Ercc8 UTSW 13 108160714 missense probably damaging 1.00
R3857:Ercc8 UTSW 13 108194114 missense possibly damaging 0.82
R4941:Ercc8 UTSW 13 108160767 unclassified probably benign
R5585:Ercc8 UTSW 13 108175589 missense probably damaging 0.99
R6023:Ercc8 UTSW 13 108178577 missense probably damaging 1.00
R6363:Ercc8 UTSW 13 108183870 missense probably damaging 1.00
R6483:Ercc8 UTSW 13 108183810 missense probably damaging 0.99
R6825:Ercc8 UTSW 13 108158809 missense probably damaging 0.97
R7166:Ercc8 UTSW 13 108169433 missense possibly damaging 0.94
R7710:Ercc8 UTSW 13 108183863 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGTGAAGGCCATCATACTTTG -3'
(R):5'- TAGCATGTCAATGAGAGAAGACTC -3'

Sequencing Primer
(F):5'- GAAGGCCATCATACTTTGTTTAATG -3'
(R):5'- GCCTTCACCAATTAAAATTGAAAACG -3'
Posted On2019-05-15