Mutagenetix > Incidental Mutations

Incidental Mutation 'R7151:Ift140'

554164

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25055725 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 790 (D790E)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024984] [ENSMUST00000137386] [ENSMUST00000153745]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024983
AA Change: D790E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: D790E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000024984

SMART Domains

Protein: ENSMUSP00000024984
Gene: ENSMUSG00000024168

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
transmembrane domain	102	124	N/A	INTRINSIC
transmembrane domain	139	161	N/A	INTRINSIC
transmembrane domain	168	190	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137386
AA Change: D790E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: D790E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000153745

SMART Domains

Protein: ENSMUSP00000119536
Gene: ENSMUSG00000024168

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	42	64	N/A	INTRINSIC
transmembrane domain	71	93	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6330409D20Rik	T	A	2: 32,740,606	Q52L	unknown	Het
Acsl1	A	G	8: 46,513,597	D202G	probably damaging	Het
Adam3	A	T	8: 24,695,255	C476S	probably damaging	Het
Adam34	T	A	8: 43,651,462	E382V	probably benign	Het
Akap5	G	A	12: 76,328,249	V152I	probably benign	Het
Aldh5a1	C	T	13: 24,937,399	W57*	probably null	Het
Angptl2	C	T	2: 33,243,910	Q415*	probably null	Het
Bnc1	G	T	7: 81,973,307	T724N	possibly damaging	Het
Brca2	T	C	5: 150,541,436	V1555A	probably benign	Het
Btn1a1	T	A	13: 23,459,313	D322V	probably damaging	Het
Chsy3	T	A	18: 59,409,285	D498E	possibly damaging	Het
Ddx24	T	C	12: 103,424,088	T215A	probably benign	Het
Dhx57	A	T	17: 80,273,047	V492E	probably damaging	Het
Dnhd1	G	A	7: 105,710,027	R3523Q	probably benign	Het
Dock3	T	A	9: 106,964,717	D971V	possibly damaging	Het
Ercc8	T	C	13: 108,187,282		probably null	Het
Erich5	T	A	15: 34,470,949	L108Q	probably damaging	Het
F5	A	T	1: 164,201,661	Y1743F	probably damaging	Het
Fam196a	A	C	7: 134,918,645	I52S	probably damaging	Het
Gale	T	C	4: 135,967,192	V243A	probably damaging	Het
Gspt1	T	A	16: 11,253,828	Q57L	probably benign	Het
Gtf3a	C	A	5: 146,951,275	Q129K	probably benign	Het
Heyl	T	C	4: 123,246,461	V271A	probably benign	Het
Hsd17b4	T	C	18: 50,128,370	F7L	probably damaging	Het
Hspa12a	T	C	19: 58,822,162	T150A	probably benign	Het
Igkv4-69	T	A	6: 69,283,933	Y70F	probably damaging	Het
Il1rap	T	C	16: 26,712,128	Y405H	probably damaging	Het
Irf2bpl	G	T	12: 86,883,353	P182Q	probably benign	Het
Itm2b	C	A	14: 73,368,389		probably benign	Het
Kcnc2	T	C	10: 112,458,509	V106A	possibly damaging	Het
Krt83	C	A	15: 101,489,648	D170Y	probably damaging	Het
Lca5	T	A	9: 83,398,640	Y369F	probably benign	Het
Mgat5	T	A	1: 127,446,262	D466E	probably damaging	Het
Mier3	C	T	13: 111,714,768	P428L	probably benign	Het
Myo6	T	C	9: 80,245,136	Y167H	unknown	Het
Neu2	A	G	1: 87,596,575	E94G	probably benign	Het
Nlrp9a	A	T	7: 26,557,247	K97*	probably null	Het
Npdc1	A	G	2: 25,409,108	M306V	probably damaging	Het
Odf2l	A	T	3: 145,127,066	N95I	probably benign	Het
Olfr1101	A	G	2: 86,989,041	V45A	probably benign	Het
Olfr218	A	G	1: 173,204,066	K237E	probably damaging	Het
Olfr270	G	T	4: 52,970,665	V15L	probably benign	Het
Olfr836	A	G	9: 19,121,741	Y259C	possibly damaging	Het
P2ry12	A	G	3: 59,217,706	F183L	probably benign	Het
Proser3	A	G	7: 30,540,324	F452L	possibly damaging	Het
Ptgfrn	G	T	3: 101,080,195	Y117*	probably null	Het
Rab3gap2	G	T	1: 185,248,053	V360F	probably benign	Het
Rp1l1	A	T	14: 64,029,026	D687V	possibly damaging	Het
Rxfp2	T	G	5: 150,043,107	N103K	probably benign	Het
Scfd2	T	A	5: 74,397,665	Q517L	possibly damaging	Het
Scnn1b	G	A	7: 121,917,886	A582T	probably damaging	Het
Serpinb6e	T	C	13: 33,837,835	E170G	probably damaging	Het
Serpinb8	T	A	1: 107,605,797	V194E	probably damaging	Het
Sgcz	T	A	8: 37,539,679	H191L	possibly damaging	Het
Sirt1	A	T	10: 63,323,996	L435Q	probably damaging	Het
Sorcs1	G	A	19: 50,312,982	P315S	probably damaging	Het
Spdef	T	A	17: 27,720,160	S71C	possibly damaging	Het
Spta1	T	A	1: 174,197,751	H727Q	probably damaging	Het
Srsf1	C	T	11: 88,049,258	Q199*	probably null	Het
Stard9	A	T	2: 120,696,142	D960V	probably benign	Het
Tcp10c	A	T	17: 13,355,904	I49F	possibly damaging	Het
Tgm2	T	C	2: 158,129,395	N308S	possibly damaging	Het
Tiam2	A	G	17: 3,448,385	D812G	probably benign	Het
Tph1	A	T	7: 46,662,117	V67D	possibly damaging	Het
Trps1	C	T	15: 50,822,397	R794H	possibly damaging	Het
Ttn	C	T	2: 76,853,161	A906T		Het
Vmn1r124	G	A	7: 21,260,259	P120L	probably benign	Het
Vmn2r92	A	T	17: 18,166,743	T115S	probably benign	Het
Wdr11	A	G	7: 129,606,652	D377G	probably damaging	Het
Wdr55	G	T	18: 36,762,936	A251S	possibly damaging	Het
Zbtb7b	C	T	3: 89,380,902	R203H	probably benign	Het
Zfp109	A	T	7: 24,229,806	H67Q	probably benign	Het
Zfp462	G	A	4: 55,051,271	C2248Y	probably damaging	Het
Zyg11b	T	C	4: 108,244,922	H534R	possibly damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	unclassified	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGCATATGGGGTCTTTGTCTTC -3'
(R):5'- GGGTCTGATGGGCATTTCAC -3'

Sequencing Primer
(F):5'- TCCAGCCTGGAGAAGCAGAC -3'
(R):5'- CTTAGGCACTAGGCACACATGTG -3'

Posted On

2019-05-15