Incidental Mutation 'R7151:Dhx57'
ID554166
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80273047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 492 (V492E)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: V439E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V439E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: V492E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V492E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Acsl1 A G 8: 46,513,597 D202G probably damaging Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Angptl2 C T 2: 33,243,910 Q415* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Ercc8 T C 13: 108,187,282 probably null Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tiam2 A G 17: 3,448,385 D812G probably benign Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Wdr55 G T 18: 36,762,936 A251S possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGTTTTAACGTTCAGAGCAAAC -3'
(R):5'- CCCTGTTTCAGAGCAGTATGG -3'

Sequencing Primer
(F):5'- TTTAACGTTCAGAGCAAACCAAAAG -3'
(R):5'- GAAGTTGTTTCAGTCAAACCTCAGGG -3'
Posted On2019-05-15