Incidental Mutation 'R7151:Wdr55'
ID554167
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene NameWD repeat domain 55
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36760239-36763708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36762936 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 251 (A251S)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000049323] [ENSMUST00000061522]
Predicted Effect probably benign
Transcript: ENSMUST00000001416
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049323
AA Change: A251S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: A251S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Acsl1 A G 8: 46,513,597 D202G probably damaging Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Angptl2 C T 2: 33,243,910 Q415* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dhx57 A T 17: 80,273,047 V492E probably damaging Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Ercc8 T C 13: 108,187,282 probably null Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tiam2 A G 17: 3,448,385 D812G probably benign Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36762079 critical splice donor site probably null
IGL02720:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02723:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02726:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02728:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02729:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02731:Wdr55 APN 18 36763382 missense probably benign 0.12
R1420:Wdr55 UTSW 18 36760339 missense probably benign 0.00
R1952:Wdr55 UTSW 18 36760384 missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36763100 missense probably benign 0.00
R4497:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R4937:Wdr55 UTSW 18 36762398 missense probably benign 0.00
R5662:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R6315:Wdr55 UTSW 18 36762069 missense probably damaging 1.00
R6499:Wdr55 UTSW 18 36762178 missense probably benign 0.00
R6679:Wdr55 UTSW 18 36763124 missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36760420 missense probably damaging 1.00
R7687:Wdr55 UTSW 18 36762023 missense probably damaging 1.00
R7808:Wdr55 UTSW 18 36760416 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTACTCTCAGAGCCTCAGTCAG -3'
(R):5'- TTGGCAGGATGTTCACAGC -3'

Sequencing Primer
(F):5'- CCCTCATGAAAGTACAGCTGGG -3'
(R):5'- ATGTTCACAGCCCTGAGC -3'
Posted On2019-05-15