Incidental Mutation 'R7152:Tead2'
ID554199
Institutional Source Beutler Lab
Gene Symbol Tead2
Ensembl Gene ENSMUSG00000030796
Gene NameTEA domain family member 2
SynonymsTEAD-2, TEF-4, Etdf
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7152 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45215753-45233644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45220447 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 124 (S124T)
Ref Sequence ENSEMBL: ENSMUSP00000033060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000097216] [ENSMUST00000107801] [ENSMUST00000209343] [ENSMUST00000209437] [ENSMUST00000209678] [ENSMUST00000210447] [ENSMUST00000211744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033060
AA Change: S124T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796
AA Change: S124T

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000097216
AA Change: S89T

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796
AA Change: S89T

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107801
AA Change: S124T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796
AA Change: S124T

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000209343
AA Change: S124T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000209437
Predicted Effect possibly damaging
Transcript: ENSMUST00000209678
AA Change: S56T

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210447
AA Change: S124T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211744
AA Change: S124T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1006 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a functionally null allele of this gene exhibit no gross abnormalities and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 T C 13: 113,318,850 F477L Het
Btnl10 A G 11: 58,922,397 N284S probably benign Het
Casz1 C G 4: 148,901,291 probably benign Het
Cdkn2c A T 4: 109,665,038 F37I probably damaging Het
Cdyl2 T C 8: 116,624,327 K22E probably damaging Het
Cers1 T C 8: 70,318,251 W104R probably damaging Het
Cgrrf1 T A 14: 46,853,477 Y223* probably null Het
Cited2 C A 10: 17,724,386 N147K probably benign Het
Clip2 A T 5: 134,496,241 L904Q probably damaging Het
Cntln T C 4: 84,884,700 V79A possibly damaging Het
Cntnap1 C T 11: 101,177,326 R55W probably damaging Het
Ctnna2 T A 6: 76,980,824 T481S possibly damaging Het
Ddx17 T C 15: 79,530,263 T570A possibly damaging Het
Epha7 A G 4: 28,935,826 K483E possibly damaging Het
Eps8l2 A T 7: 141,355,765 I150F possibly damaging Het
Esyt1 A G 10: 128,515,760 S827P possibly damaging Het
Fbxl13 T A 5: 21,582,067 I291F possibly damaging Het
Foxd3 A C 4: 99,657,325 H234P probably benign Het
Ggta1 T A 2: 35,402,699 M199L probably benign Het
Hist2h3b A G 3: 96,268,938 D82G probably benign Het
Ighv5-15 T C 12: 113,826,697 E101G probably benign Het
Igkv8-18 T C 6: 70,356,221 L49P probably damaging Het
Itpr1 T C 6: 108,394,407 probably null Het
Klhl36 C T 8: 119,870,214 T218M probably benign Het
Ltn1 A G 16: 87,427,641 F65S probably damaging Het
March3 A G 18: 56,775,981 V244A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ndst3 T A 3: 123,552,656 I642F possibly damaging Het
Neb T C 2: 52,263,545 D2456G probably damaging Het
Nphp1 A G 2: 127,753,979 M522T probably benign Het
Olfr1080 C T 2: 86,553,329 S265N probably benign Het
Olfr639 T A 7: 104,012,019 M228L probably benign Het
Pam T A 1: 97,885,740 M322L probably damaging Het
Pcdhgb1 C A 18: 37,681,801 H448Q probably benign Het
Pcnt T C 10: 76,411,360 probably null Het
Pgm3 A T 9: 86,567,540 D142E probably benign Het
Pomgnt2 C T 9: 121,983,523 G64D probably damaging Het
Sds A T 5: 120,481,651 probably null Het
Sirpb1b G T 3: 15,542,170 Q351K probably benign Het
Slc2a12 T A 10: 22,665,554 M436K probably benign Het
Slc9a5 G A 8: 105,368,393 G872D probably benign Het
Stxbp2 T G 8: 3,632,583 S57R probably benign Het
Sult2a6 T A 7: 14,222,520 D272V probably benign Het
Supt5 A G 7: 28,323,900 M318T probably benign Het
Tdpoz3 T C 3: 93,826,465 V149A probably damaging Het
Tssc4 T A 7: 143,070,402 V149D probably damaging Het
Ttn C T 2: 76,853,161 A906T Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn1r37 T C 6: 66,731,899 Y170H probably benign Het
Vnn3 T A 10: 23,851,615 V11E possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfhx3 T C 8: 108,948,207 V1963A possibly damaging Het
Zfp324 C A 7: 12,966,271 A19E probably benign Het
Zfyve26 T C 12: 79,279,114 S784G probably benign Het
Other mutations in Tead2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Tead2 APN 7 45217251 missense probably damaging 0.96
IGL01887:Tead2 APN 7 45232310 missense probably damaging 1.00
IGL02378:Tead2 APN 7 45218147 critical splice donor site probably null
IGL02441:Tead2 APN 7 45217421 missense probably damaging 1.00
IGL02716:Tead2 APN 7 45232296 nonsense probably null
IGL02939:Tead2 APN 7 45220434 splice site probably benign
IGL03302:Tead2 APN 7 45232899 missense possibly damaging 0.86
R0325:Tead2 UTSW 7 45225755 missense probably damaging 1.00
R0611:Tead2 UTSW 7 45217250 missense probably damaging 0.99
R2571:Tead2 UTSW 7 45225770 missense probably damaging 1.00
R3401:Tead2 UTSW 7 45223673 unclassified probably benign
R3847:Tead2 UTSW 7 45232328 unclassified probably null
R3849:Tead2 UTSW 7 45232328 unclassified probably null
R3850:Tead2 UTSW 7 45232328 unclassified probably null
R5729:Tead2 UTSW 7 45220742 unclassified probably benign
R5932:Tead2 UTSW 7 45232899 missense probably benign 0.00
R5956:Tead2 UTSW 7 45220714 unclassified probably benign
R6208:Tead2 UTSW 7 45218102 missense probably damaging 1.00
R6729:Tead2 UTSW 7 45217234 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGGTCAGACTCTGAATG -3'
(R):5'- ACATCCCCTGTGGCCATTAC -3'

Sequencing Primer
(F):5'- ACTCTGAATGTGCTGAGTCC -3'
(R):5'- GGCCATTACAGCCCCATC -3'
Posted On2019-05-15