Incidental Mutation 'R7153:Btbd18'
ID554235
Institutional Source Beutler Lab
Gene Symbol Btbd18
Ensembl Gene ENSMUSG00000086598
Gene NameBTB (POZ) domain containing 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84659079-84668780 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 84666428 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 137 (R137*)
Ref Sequence ENSEMBL: ENSMUSP00000142247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053664] [ENSMUST00000102646] [ENSMUST00000102647] [ENSMUST00000111664] [ENSMUST00000111665] [ENSMUST00000117299] [ENSMUST00000133437] [ENSMUST00000189636] [ENSMUST00000189772] [ENSMUST00000189988]
Predicted Effect probably benign
Transcript: ENSMUST00000053664
SMART Domains Protein: ENSMUSP00000059582
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102646
SMART Domains Protein: ENSMUSP00000099706
Gene: ENSMUSG00000076437

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102647
SMART Domains Protein: ENSMUSP00000099707
Gene: ENSMUSG00000076437

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111664
SMART Domains Protein: ENSMUSP00000107293
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:Thioredoxin 99 205 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111665
SMART Domains Protein: ENSMUSP00000107294
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117299
SMART Domains Protein: ENSMUSP00000112635
Gene: ENSMUSG00000076437

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133437
AA Change: R137*
SMART Domains Protein: ENSMUSP00000142247
Gene: ENSMUSG00000086598
AA Change: R137*

DomainStartEndE-ValueType
BTB 34 132 4.96e-11 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189636
SMART Domains Protein: ENSMUSP00000139830
Gene: ENSMUSG00000076437

DomainStartEndE-ValueType
Pfam:Rdx 28 109 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189772
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189988
SMART Domains Protein: ENSMUSP00000139492
Gene: ENSMUSG00000076437

DomainStartEndE-ValueType
Pfam:Rdx 28 96 1e-6 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased male germ cell apoptosis and arrested spermiogenesis resulting in azoospermia and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Btbd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4519:Btbd18 UTSW 2 84667580 missense probably damaging 1.00
R4751:Btbd18 UTSW 2 84667921 nonsense probably null
R5209:Btbd18 UTSW 2 84668099 missense possibly damaging 0.90
R7126:Btbd18 UTSW 2 84666202 missense possibly damaging 0.84
R7362:Btbd18 UTSW 2 84661543 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGAGGCCTAAAGATCCAAAC -3'
(R):5'- TCTGCTTTCTTGAGTCAGGC -3'

Sequencing Primer
(F):5'- CACTAAGGAAGCTTGTGGACTTCC -3'
(R):5'- GCTGAGTATCTGACAAGCTATCTGC -3'
Posted On2019-05-15