Incidental Mutation 'R7153:Rraga'
ID554245
Institutional Source Beutler Lab
Gene Symbol Rraga
Ensembl Gene ENSMUSG00000070934
Gene NameRas-related GTP binding A
Synonyms1300010C19Rik, FIP-1
MMRRC Submission
Accession Numbers

Genbank: NM_178376.3

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86575668-86577285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86576016 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 33 (A33V)
Ref Sequence ENSEMBL: ENSMUSP00000088591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607] [ENSMUST00000091064]
Predicted Effect probably benign
Transcript: ENSMUST00000070607
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091064
AA Change: A33V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088591
Gene: ENSMUSG00000070934
AA Change: A33V

DomainStartEndE-ValueType
Pfam:Arf 1 176 6.3e-10 PFAM
Pfam:MMR_HSR1 9 130 1e-7 PFAM
Pfam:Roc 9 131 3.9e-10 PFAM
Pfam:Ras 9 177 3.2e-10 PFAM
Pfam:Gtr1_RagA 9 235 2.5e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a constitutively active knock-in allele exhibit neonatal lethality associated with impaired hepatic gluconeogenesis and impaired autophagy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Rraga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03197:Rraga APN 4 86576276 missense probably damaging 0.98
I2289:Rraga UTSW 4 86576285 missense probably damaging 1.00
R0612:Rraga UTSW 4 86576327 missense probably damaging 1.00
R0624:Rraga UTSW 4 86576217 missense probably benign 0.00
R1477:Rraga UTSW 4 86576759 missense probably benign
R1804:Rraga UTSW 4 86576444 missense probably damaging 0.99
R4167:Rraga UTSW 4 86576067 missense possibly damaging 0.95
R6488:Rraga UTSW 4 86576328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTTCTGAGACCTCGC -3'
(R):5'- CGTATATCAGAACCTCCACATTACG -3'

Sequencing Primer
(F):5'- TCTGAGACCTCGCCTCGC -3'
(R):5'- CACATTACGGAAGATGTTGTCCCG -3'
Posted On2019-05-15