Mutagenetix > Incidental Mutation

Incidental Mutation 'R7153:Pik3c2a'

554258

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7153 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116342252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1593 (N1593S)

Ref Sequence

ENSEMBL: ENSMUSP00000126092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: N1593S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: N1593S

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: N1593S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	A	G	6: 125,992,943	T741A	possibly damaging	Het
Aox4	T	C	1: 58,250,219	M767T	probably damaging	Het
Arhgap39	C	A	15: 76,765,491	S27I	probably benign	Het
AU018091	T	A	7: 3,159,513	M296L	probably benign	Het
Axin1	A	G	17: 26,187,968	T512A	probably benign	Het
B4galnt3	A	T	6: 120,214,968	D602E	probably benign	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bsnd	A	T	4: 106,492,033	D3E	probably benign	Het
Btbd18	C	T	2: 84,666,428	R137*	probably null	Het
C2cd5	A	G	6: 143,019,409	S871P	probably benign	Het
Cobl	G	T	11: 12,254,128	P858Q	probably damaging	Het
Col6a1	C	T	10: 76,710,341		probably null	Het
Crb2	A	T	2: 37,787,408	H304L	probably benign	Het
Crybg1	T	A	10: 43,964,666	Y1812F	possibly damaging	Het
Ddx60	A	T	8: 61,988,108	K1070N	possibly damaging	Het
Defb22	T	C	2: 152,485,920	K115R	unknown	Het
Dhx8	C	T	11: 101,740,175		probably null	Het
Dnah5	T	A	15: 28,365,522		probably null	Het
Dnah7b	T	A	1: 46,126,804	F543Y	probably benign	Het
Ehhadh	A	G	16: 21,766,321	F270S	probably damaging	Het
Esyt2	A	G	12: 116,346,508	M397V	probably benign	Het
Fanca	A	T	8: 123,316,425	L74H	probably damaging	Het
Fbxl17	C	A	17: 63,060,351	V676F	probably benign	Het
Fndc1	A	G	17: 7,801,645	V102A	probably damaging	Het
Gpalpp1	T	C	14: 76,095,011	Y273C	probably damaging	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Grik2	T	C	10: 49,535,367	H225R	probably benign	Het
Helz2	A	T	2: 181,231,285	S2411T	probably benign	Het
Hnmt	C	T	2: 24,014,341	A103T	probably damaging	Het
Ighv15-2	G	T	12: 114,564,590	Y114*	probably null	Het
Irak2	A	G	6: 113,678,709	H357R	probably benign	Het
Kcp	T	C	6: 29,499,015	E320G	probably damaging	Het
Kpna4	A	G	3: 69,089,798	L352S	probably damaging	Het
Krt36	G	A	11: 100,105,146	Q151*	probably null	Het
Krt77	G	A	15: 101,865,496	T241M	probably benign	Het
Lca5l	T	A	16: 96,173,809	N305I	probably damaging	Het
Lefty1	T	A	1: 180,937,767	L300Q	probably benign	Het
Mertk	A	G	2: 128,736,649	Y185C	probably damaging	Het
Mmp14	T	C	14: 54,436,251	I124T	possibly damaging	Het
Nlrc4	T	C	17: 74,447,103	E95G	possibly damaging	Het
Npc1	A	G	18: 12,213,291	F283L	possibly damaging	Het
Olfr1180	A	C	2: 88,412,118	L180W	probably damaging	Het
Olfr1282	A	T	2: 111,335,901	M59K	probably damaging	Het
Pcdha11	T	C	18: 37,011,225	V123A	probably damaging	Het
Pcdhga2	T	C	18: 37,669,208	V35A	probably damaging	Het
Pgd	G	T	4: 149,161,678	T94K	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plcb3	A	G	19: 6,958,084		probably null	Het
Prkd3	C	T	17: 78,966,355	D491N	probably benign	Het
Ptprf	T	C	4: 118,231,543	T688A	probably damaging	Het
Pycr2	T	A	1: 180,906,682	L210M	probably damaging	Het
Rpl36	T	C	17: 56,614,137	I81T	probably benign	Het
Rraga	C	T	4: 86,576,016	A33V	probably damaging	Het
Slc29a1	G	A	17: 45,585,762	A429V	probably damaging	Het
Stab1	T	G	14: 31,160,584	E432A	probably benign	Het
Synj1	C	T	16: 90,948,090	G1189R	probably benign	Het
Synpo2	A	G	3: 123,112,404	*1088Q	probably null	Het
Tbc1d21	T	C	9: 58,363,093	D133G	probably damaging	Het
Tenm2	A	G	11: 36,024,182	V2176A	probably damaging	Het
Tff1	A	G	17: 31,162,798	I35T	probably benign	Het
Thnsl1	T	C	2: 21,212,953	V506A	possibly damaging	Het
Timm10b	A	G	7: 105,640,880	Q50R	unknown	Het
Tjp2	A	T	19: 24,101,981	N843K	probably benign	Het
Tle1	A	T	4: 72,139,061	F101I	probably benign	Het
Tmem225	T	C	9: 40,148,368	F15L	probably benign	Het
Trav12-3	T	C	14: 53,622,161	L88P	probably benign	Het
Ttc7b	A	T	12: 100,355,034	W613R	probably damaging	Het
Ttn	T	A	2: 76,778,504	M17723L	probably benign	Het
Ttn	T	C	2: 76,945,316	D1840G	unknown	Het
Tubgcp2	T	C	7: 140,001,036	H668R	probably benign	Het
Ush2a	C	A	1: 188,728,484	N2647K	possibly damaging	Het
Vmn1r14	C	T	6: 57,233,866	S143F	probably benign	Het
Vmn2r70	A	G	7: 85,565,054	S297P	probably damaging	Het
Ywhab	T	C	2: 164,014,060	F119L	probably damaging	Het
Zmym2	T	A	14: 56,950,202	D1108E	probably benign	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATACTGTTCAGCTCACGTGGG -3'
(R):5'- CAGTGAAGTTATCTGTTTCTTACCG -3'

Sequencing Primer
(F):5'- GGGTTCAATTCTCATCAGCTACAGG -3'
(R):5'- GAAATGGCACCCTCTTCATCATGG -3'

Posted On

2019-05-15