Incidental Mutation 'R7153:Ddx60'
ID554260
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61988108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1070 (K1070N)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070631
AA Change: K1069N

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: K1069N

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: K1070N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: K1070N

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTTTCTTCAGAGGCCTGC -3'
(R):5'- AGAATCACTACACATCAAGTTGAGC -3'

Sequencing Primer
(F):5'- TTTCTAACCGTAAACATCTCCAGC -3'
(R):5'- CAATACAGAATGCTGTGTGAA -3'
Posted On2019-05-15