Mutagenetix > Incidental Mutation

Incidental Mutation 'R7153:Tenm2'

554268

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R7153 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36024182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2176 (V2176A)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: V2176A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: V2176A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102801
AA Change: V2175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: V2175A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163524
AA Change: V2175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: V2175A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	A	G	6: 125,992,943	T741A	possibly damaging	Het
Aox4	T	C	1: 58,250,219	M767T	probably damaging	Het
Arhgap39	C	A	15: 76,765,491	S27I	probably benign	Het
AU018091	T	A	7: 3,159,513	M296L	probably benign	Het
Axin1	A	G	17: 26,187,968	T512A	probably benign	Het
B4galnt3	A	T	6: 120,214,968	D602E	probably benign	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Bsnd	A	T	4: 106,492,033	D3E	probably benign	Het
Btbd18	C	T	2: 84,666,428	R137*	probably null	Het
C2cd5	A	G	6: 143,019,409	S871P	probably benign	Het
Cobl	G	T	11: 12,254,128	P858Q	probably damaging	Het
Col6a1	C	T	10: 76,710,341		probably null	Het
Crb2	A	T	2: 37,787,408	H304L	probably benign	Het
Crybg1	T	A	10: 43,964,666	Y1812F	possibly damaging	Het
Ddx60	A	T	8: 61,988,108	K1070N	possibly damaging	Het
Defb22	T	C	2: 152,485,920	K115R	unknown	Het
Dhx8	C	T	11: 101,740,175		probably null	Het
Dnah5	T	A	15: 28,365,522		probably null	Het
Dnah7b	T	A	1: 46,126,804	F543Y	probably benign	Het
Ehhadh	A	G	16: 21,766,321	F270S	probably damaging	Het
Esyt2	A	G	12: 116,346,508	M397V	probably benign	Het
Fanca	A	T	8: 123,316,425	L74H	probably damaging	Het
Fbxl17	C	A	17: 63,060,351	V676F	probably benign	Het
Fndc1	A	G	17: 7,801,645	V102A	probably damaging	Het
Gpalpp1	T	C	14: 76,095,011	Y273C	probably damaging	Het
Gpatch8	TTCCTCCTCCTCCTCTTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC	11: 102,480,188		probably benign	Het
Grik2	T	C	10: 49,535,367	H225R	probably benign	Het
Helz2	A	T	2: 181,231,285	S2411T	probably benign	Het
Hnmt	C	T	2: 24,014,341	A103T	probably damaging	Het
Ighv15-2	G	T	12: 114,564,590	Y114*	probably null	Het
Irak2	A	G	6: 113,678,709	H357R	probably benign	Het
Kcp	T	C	6: 29,499,015	E320G	probably damaging	Het
Kpna4	A	G	3: 69,089,798	L352S	probably damaging	Het
Krt36	G	A	11: 100,105,146	Q151*	probably null	Het
Krt77	G	A	15: 101,865,496	T241M	probably benign	Het
Lca5l	T	A	16: 96,173,809	N305I	probably damaging	Het
Lefty1	T	A	1: 180,937,767	L300Q	probably benign	Het
Mertk	A	G	2: 128,736,649	Y185C	probably damaging	Het
Mmp14	T	C	14: 54,436,251	I124T	possibly damaging	Het
Nlrc4	T	C	17: 74,447,103	E95G	possibly damaging	Het
Npc1	A	G	18: 12,213,291	F283L	possibly damaging	Het
Olfr1180	A	C	2: 88,412,118	L180W	probably damaging	Het
Olfr1282	A	T	2: 111,335,901	M59K	probably damaging	Het
Pcdha11	T	C	18: 37,011,225	V123A	probably damaging	Het
Pcdhga2	T	C	18: 37,669,208	V35A	probably damaging	Het
Pgd	G	T	4: 149,161,678	T94K	probably benign	Het
Pik3c2a	T	C	7: 116,342,252	N1593S	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plcb3	A	G	19: 6,958,084		probably null	Het
Prkd3	C	T	17: 78,966,355	D491N	probably benign	Het
Ptprf	T	C	4: 118,231,543	T688A	probably damaging	Het
Pycr2	T	A	1: 180,906,682	L210M	probably damaging	Het
Rpl36	T	C	17: 56,614,137	I81T	probably benign	Het
Rraga	C	T	4: 86,576,016	A33V	probably damaging	Het
Slc29a1	G	A	17: 45,585,762	A429V	probably damaging	Het
Stab1	T	G	14: 31,160,584	E432A	probably benign	Het
Synj1	C	T	16: 90,948,090	G1189R	probably benign	Het
Synpo2	A	G	3: 123,112,404	*1088Q	probably null	Het
Tbc1d21	T	C	9: 58,363,093	D133G	probably damaging	Het
Tff1	A	G	17: 31,162,798	I35T	probably benign	Het
Thnsl1	T	C	2: 21,212,953	V506A	possibly damaging	Het
Timm10b	A	G	7: 105,640,880	Q50R	unknown	Het
Tjp2	A	T	19: 24,101,981	N843K	probably benign	Het
Tle1	A	T	4: 72,139,061	F101I	probably benign	Het
Tmem225	T	C	9: 40,148,368	F15L	probably benign	Het
Trav12-3	T	C	14: 53,622,161	L88P	probably benign	Het
Ttc7b	A	T	12: 100,355,034	W613R	probably damaging	Het
Ttn	T	A	2: 76,778,504	M17723L	probably benign	Het
Ttn	T	C	2: 76,945,316	D1840G	unknown	Het
Tubgcp2	T	C	7: 140,001,036	H668R	probably benign	Het
Ush2a	C	A	1: 188,728,484	N2647K	possibly damaging	Het
Vmn1r14	C	T	6: 57,233,866	S143F	probably benign	Het
Vmn2r70	A	G	7: 85,565,054	S297P	probably damaging	Het
Ywhab	T	C	2: 164,014,060	F119L	probably damaging	Het
Zmym2	T	A	14: 56,950,202	D1108E	probably benign	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACGGAGGTCATAGCGTAAG -3'
(R):5'- ACCGCTATGATGAGATTTCCGG -3'

Sequencing Primer
(F):5'- TCATAGCGTAAGGGCATGAGGC -3'
(R):5'- TTTCCGGCAAGGTGGAAC -3'

Posted On

2019-05-15