Incidental Mutation 'R7153:Mmp14'
ID554276
Institutional Source Beutler Lab
Gene Symbol Mmp14
Ensembl Gene ENSMUSG00000000957
Gene Namematrix metallopeptidase 14 (membrane-inserted)
Synonymssabe, Membrane type 1-MMP, MT1-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54431612-54445364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54436251 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 124 (I124T)
Ref Sequence ENSEMBL: ENSMUSP00000087119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089688] [ENSMUST00000196155] [ENSMUST00000197874] [ENSMUST00000225641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089688
AA Change: I124T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087119
Gene: ENSMUSG00000000957
AA Change: I124T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:PG_binding_1 36 88 2.1e-12 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
Pfam:DUF3377 512 582 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196155
Predicted Effect probably benign
Transcript: ENSMUST00000197874
Predicted Effect probably damaging
Transcript: ENSMUST00000225641
AA Change: I124T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations may lead to postnatal or premature death, craniofacial anomalies, skeletal dysplasia, low body weight, reduced bone formation and chondrocyte proliferation, arthritis, and fibrosis as well as defects in angiogenesis and lung, tooth,kidney, and submaxillary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Mmp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mmp14 APN 14 54435790 missense possibly damaging 0.60
IGL01937:Mmp14 APN 14 54437596 splice site probably benign
IGL02565:Mmp14 APN 14 54440557 missense probably benign 0.02
cartoon UTSW 14 54439999 missense probably damaging 0.96
IGL03134:Mmp14 UTSW 14 54439106 missense probably damaging 1.00
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0538:Mmp14 UTSW 14 54438709 missense possibly damaging 0.47
R0612:Mmp14 UTSW 14 54440434 missense probably damaging 1.00
R2352:Mmp14 UTSW 14 54440545 missense probably benign 0.30
R3700:Mmp14 UTSW 14 54431932 unclassified probably benign
R4289:Mmp14 UTSW 14 54436208 nonsense probably null
R4888:Mmp14 UTSW 14 54436205 missense probably damaging 0.98
R5068:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5069:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5070:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5216:Mmp14 UTSW 14 54437663 missense possibly damaging 0.82
R5607:Mmp14 UTSW 14 54439412 missense probably damaging 1.00
R6053:Mmp14 UTSW 14 54435890 missense probably benign 0.39
R6477:Mmp14 UTSW 14 54437658 missense probably damaging 1.00
R7212:Mmp14 UTSW 14 54435879 missense probably damaging 1.00
R7555:Mmp14 UTSW 14 54437742 missense possibly damaging 0.96
X0064:Mmp14 UTSW 14 54431946 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGGTCAACTACAGCACTACAC -3'
(R):5'- AGGCTTAGGGGATCTTCAGG -3'

Sequencing Primer
(F):5'- ACACTCTGTCCCTTTGAAGATGG -3'
(R):5'- CGAGAGTGTATGCTCTTCAAAATGGC -3'
Posted On2019-05-15