Incidental Mutation 'R7153:Zmym2'
ID554277
Institutional Source Beutler Lab
Gene Symbol Zmym2
Ensembl Gene ENSMUSG00000021945
Gene Namezinc finger, MYM-type 2
SynonymsRAMP, FIM, MYM, Zfp198, SCLL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56886653-56962701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56950202 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1108 (D1108E)
Ref Sequence ENSEMBL: ENSMUSP00000022511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022511]
Predicted Effect probably benign
Transcript: ENSMUST00000022511
AA Change: D1108E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022511
Gene: ENSMUSG00000021945
AA Change: D1108E

DomainStartEndE-ValueType
TRASH 330 366 1.55e-5 SMART
TRASH 372 412 7.69e-1 SMART
TRASH 424 459 7.5e1 SMART
TRASH 466 505 6.53e-4 SMART
Pfam:zf-FCS 527 569 1.8e-9 PFAM
TRASH 583 619 4.79e1 SMART
TRASH 638 674 8.49e-3 SMART
TRASH 680 715 7.28e-2 SMART
TRASH 726 761 1.95e-2 SMART
TRASH 767 802 3.89e1 SMART
low complexity region 881 895 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
Pfam:DUF3504 1191 1359 7.3e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a protein that contains nine MYM-type zinc finger motifs. Expression of this gene may mediate the inhibition of hematopoietic cell development during ontogeny, and the encoded protein may also play a role in transforming growth factor-beta signaling as a Smad binding protein. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Other mutations in Zmym2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Zmym2 APN 14 56947937 splice site probably benign
IGL00587:Zmym2 APN 14 56903360 missense possibly damaging 0.86
IGL00736:Zmym2 APN 14 56903211 missense probably benign 0.01
IGL00753:Zmym2 APN 14 56957060 nonsense probably null
IGL01608:Zmym2 APN 14 56948015 missense possibly damaging 0.57
IGL01744:Zmym2 APN 14 56946572 missense probably benign 0.24
IGL02150:Zmym2 APN 14 56911069 splice site probably benign
IGL02186:Zmym2 APN 14 56943351 missense probably benign 0.09
IGL02654:Zmym2 APN 14 56911315 missense probably damaging 1.00
IGL02960:Zmym2 APN 14 56938413 missense probably benign 0.09
IGL03104:Zmym2 APN 14 56950327 missense possibly damaging 0.88
IGL03162:Zmym2 APN 14 56914043 missense probably benign 0.24
IGL03356:Zmym2 APN 14 56957060 nonsense probably null
IGL03412:Zmym2 APN 14 56959719 nonsense probably null
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0132:Zmym2 UTSW 14 56943258 missense probably benign
R0270:Zmym2 UTSW 14 56949684 splice site probably null
R0834:Zmym2 UTSW 14 56956963 missense probably damaging 1.00
R1071:Zmym2 UTSW 14 56959821 missense possibly damaging 0.93
R1386:Zmym2 UTSW 14 56913091 missense probably damaging 1.00
R1442:Zmym2 UTSW 14 56943327 missense probably damaging 0.99
R1472:Zmym2 UTSW 14 56911183 missense probably benign 0.20
R1595:Zmym2 UTSW 14 56920730 missense probably benign 0.25
R1598:Zmym2 UTSW 14 56902769 missense possibly damaging 0.94
R1598:Zmym2 UTSW 14 56914067 missense probably damaging 1.00
R1916:Zmym2 UTSW 14 56959842 missense probably damaging 1.00
R2261:Zmym2 UTSW 14 56928262 missense probably damaging 1.00
R2393:Zmym2 UTSW 14 56920723 missense probably benign 0.17
R2866:Zmym2 UTSW 14 56928248 missense probably damaging 1.00
R3727:Zmym2 UTSW 14 56919349 splice site probably benign
R3847:Zmym2 UTSW 14 56921499 splice site probably benign
R4043:Zmym2 UTSW 14 56958308 splice site probably benign
R4074:Zmym2 UTSW 14 56903004 missense probably damaging 0.99
R4343:Zmym2 UTSW 14 56921562 missense probably damaging 0.99
R4420:Zmym2 UTSW 14 56956878 missense probably damaging 0.98
R4645:Zmym2 UTSW 14 56928307 missense probably damaging 1.00
R5015:Zmym2 UTSW 14 56921594 missense probably damaging 1.00
R5038:Zmym2 UTSW 14 56956180 missense possibly damaging 0.86
R5223:Zmym2 UTSW 14 56946514 missense probably benign
R5364:Zmym2 UTSW 14 56920645 missense possibly damaging 0.58
R5488:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5489:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5818:Zmym2 UTSW 14 56946529 missense probably benign
R6160:Zmym2 UTSW 14 56950309 missense probably damaging 1.00
R6437:Zmym2 UTSW 14 56903004 missense probably damaging 1.00
R7107:Zmym2 UTSW 14 56902712 missense probably benign 0.01
R7337:Zmym2 UTSW 14 56944100 missense probably benign 0.04
R7535:Zmym2 UTSW 14 56957079 missense probably damaging 1.00
R7730:Zmym2 UTSW 14 56956181 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGTGTGCATGTCTATGAATGTATTC -3'
(R):5'- TGGTTAGCCAAATAGGAATCCCAG -3'

Sequencing Primer
(F):5'- TGTGTGTGTGTGAGAGAGAGAGAG -3'
(R):5'- GAAACACTATTTGGCACTCTTCTGG -3'
Posted On2019-05-15