Incidental Mutation 'R6899:Sod3'
ID 554306
Institutional Source Beutler Lab
Gene Symbol Sod3
Ensembl Gene ENSMUSG00000072941
Gene Name superoxide dismutase 3, extracellular
Synonyms EC-SOD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6899 (G1)
Quality Score 73.0074
Status Validated
Chromosome 5
Chromosomal Location 52363791-52371418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52368708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 250 (T250A)
Ref Sequence ENSEMBL: ENSMUSP00000098768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101208]
AlphaFold O09164
Predicted Effect unknown
Transcript: ENSMUST00000101208
AA Change: T250A
SMART Domains Protein: ENSMUSP00000098768
Gene: ENSMUSG00000072941
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sod_Cu 85 224 1.5e-32 PFAM
low complexity region 233 251 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to hyperoxia, increased LPS-stimulated spleen production of TNF, and enhanced severity of collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Ero1l A C 14: 45,292,939 H345Q probably benign Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Sod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Sod3 APN 5 52368198 nonsense probably null
IGL02894:Sod3 APN 5 52368006 missense possibly damaging 0.70
R0646:Sod3 UTSW 5 52368079 missense probably benign 0.02
R1822:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1823:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1824:Sod3 UTSW 5 52368162 missense probably benign 0.07
R3872:Sod3 UTSW 5 52368289 missense probably damaging 0.98
R3934:Sod3 UTSW 5 52368645 missense probably benign 0.00
R4969:Sod3 UTSW 5 52368394 missense probably damaging 1.00
R7773:Sod3 UTSW 5 52368301 missense possibly damaging 0.94
R8964:Sod3 UTSW 5 52368354 missense probably damaging 1.00
R9779:Sod3 UTSW 5 52368093 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTTTGGCAACTTCGTGGTG -3'
(R):5'- CATGGGAGAACATCTAGGGTGC -3'

Sequencing Primer
(F):5'- AACTTCGTGGTGCGCAAC -3'
(R):5'- CATCTGGGGGCCATACAGAG -3'
Posted On 2019-05-20