Incidental Mutation 'R6927:Vstm4'
ID554313
Institutional Source Beutler Lab
Gene Symbol Vstm4
Ensembl Gene ENSMUSG00000050666
Gene NameV-set and transmembrane domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32856756-32939491 bp(+) (GRCm38)
Type of Mutationintron (71 bp from exon)
DNA Base Change (assembly) T to A at 32864002 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053175]
Predicted Effect probably null
Transcript: ENSMUST00000053175
SMART Domains Protein: ENSMUSP00000055178
Gene: ENSMUSG00000050666

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 31 153 2.11e-2 SMART
transmembrane domain 178 200 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Vstm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Vstm4 APN 14 32919245 missense probably benign 0.08
IGL02720:Vstm4 APN 14 32863617 missense probably damaging 0.99
IGL02927:Vstm4 APN 14 32937788 missense probably damaging 0.99
R0122:Vstm4 UTSW 14 32863811 unclassified probably null
R0755:Vstm4 UTSW 14 32892644 missense probably damaging 1.00
R1508:Vstm4 UTSW 14 32863554 missense probably damaging 1.00
R2075:Vstm4 UTSW 14 32917854 missense probably damaging 1.00
R2517:Vstm4 UTSW 14 32863707 missense probably benign 0.02
R3087:Vstm4 UTSW 14 32892635 missense possibly damaging 0.46
R3870:Vstm4 UTSW 14 32863755 missense probably benign 0.43
R4463:Vstm4 UTSW 14 32917876 missense probably damaging 1.00
R4731:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4732:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4733:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4860:Vstm4 UTSW 14 32863785 missense possibly damaging 0.84
R4860:Vstm4 UTSW 14 32863785 missense possibly damaging 0.84
R4983:Vstm4 UTSW 14 32919245 missense probably benign 0.08
R5059:Vstm4 UTSW 14 32863730 missense probably damaging 0.98
R5455:Vstm4 UTSW 14 32863878 missense possibly damaging 0.94
R5593:Vstm4 UTSW 14 32919290 missense probably benign 0.08
R5771:Vstm4 UTSW 14 32904569 missense probably benign 0.28
R6018:Vstm4 UTSW 14 32863670 missense probably benign 0.25
X0064:Vstm4 UTSW 14 32863721 missense probably benign 0.01
Z1177:Vstm4 UTSW 14 32863827 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATCAAGGGCAGTATGTCTG -3'
(R):5'- TCTGTCCAAAGTAAGTAGGGGC -3'

Sequencing Primer
(F):5'- GCAAAGTGCAAGAAATCAGCAAGC -3'
(R):5'- CATGACTAATACGGAGGTAGTCACTC -3'
Posted On2019-05-20