Mutagenetix > Incidental Mutations

Incidental Mutation 'R6916:Svil'

554316

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R6916 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

G to A at 5114682 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

Predicted Effect

silent
Transcript: ENSMUST00000025079

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

silent
Transcript: ENSMUST00000126977

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

silent
Transcript: ENSMUST00000127297

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000131609
AA Change: S2007N

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: S2007N

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000140448

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

silent
Transcript: ENSMUST00000143254

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

silent
Transcript: ENSMUST00000146723

SMART Domains

Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
Blast:GEL	2	37	1e-17	BLAST
SCOP:d1d0na6	53	168	3e-19	SMART
Blast:GEL	63	169	1e-72	BLAST

Predicted Effect

silent
Transcript: ENSMUST00000210707

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	A	6: 48,931,053	I329N	probably benign	Het
2700049A03Rik	T	A	12: 71,164,544	I684K	possibly damaging	Het
Abcg3	T	A	5: 104,974,735	R97S	probably benign	Het
Acin1	A	T	14: 54,665,416	F160L	probably benign	Het
Asb10	T	C	5: 24,537,856	D293G	probably damaging	Het
Atp6v1c1	T	C	15: 38,677,581	S117P	probably benign	Het
Bahcc1	T	A	11: 120,273,009	V711E	probably damaging	Het
Baz2b	A	T	2: 59,968,776	S335T	probably benign	Het
Bdkrb2	C	T	12: 105,591,779	A93V	probably damaging	Het
Cacna1d	A	T	14: 30,095,364	V1247D	probably damaging	Het
Cenpb	A	C	2: 131,179,624	F85V	probably benign	Het
Cep112	C	A	11: 108,859,376	Q142K	probably damaging	Het
Ciita	T	A	16: 10,509,207		probably null	Het
Cnr1	A	G	4: 33,943,897	D95G	probably benign	Het
Ctnnd1	A	T	2: 84,609,646	D767E	probably benign	Het
Ddx20	T	C	3: 105,680,613	N384D	probably damaging	Het
Dnaaf3	T	A	7: 4,527,533	D191V	probably damaging	Het
Efna1	T	C	3: 89,276,388	N44D	possibly damaging	Het
Errfi1	A	T	4: 150,867,473	K453*	probably null	Het
Fam149a	C	A	8: 45,350,406	K349N	probably damaging	Het
Fbxl20	T	A	11: 98,113,253	I70L	possibly damaging	Het
Flnb	C	T	14: 7,907,171	T1248I	probably damaging	Het
Frem2	T	C	3: 53,547,688	R2156G	probably damaging	Het
Ftl1	T	C	7: 45,459,540	Y31C	probably damaging	Het
Gm5862	G	T	5: 26,019,348	H208N	probably benign	Het
Hc	A	T	2: 35,010,032	Y1096*	probably null	Het
Hps1	ATCCTCCTCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTCCTC	19: 42,766,725			Het
Ints3	T	C	3: 90,406,334	D329G	probably damaging	Het
Irak3	A	T	10: 120,201,365	L32Q	probably damaging	Het
Kif1bp	T	C	10: 62,566,064	T20A	probably benign	Het
Klrb1f	A	T	6: 129,053,811	D95V	probably benign	Het
Krt79	C	T	15: 101,936,170	D260N	probably benign	Het
Lrp11	C	A	10: 7,608,714		probably null	Het
Lrrc10	C	A	10: 117,045,549	R43S	possibly damaging	Het
Muc5b	A	T	7: 141,864,717	Y3800F	possibly damaging	Het
Myh14	T	C	7: 44,629,313	K1003E	probably damaging	Het
Nbeal2	A	G	9: 110,626,108	I2567T	probably damaging	Het
Necab2	G	T	8: 119,467,616	R277L	probably damaging	Het
Nell1	T	C	7: 50,701,179	Y525H	probably benign	Het
Olfm4	T	A	14: 80,014,198	M186K	probably damaging	Het
Olfr389	T	A	11: 73,777,069	Q86L	probably benign	Het
Olfr753-ps1	T	C	17: 37,169,973	K225R	probably benign	Het
Olfr934	T	C	9: 38,982,904	I47V	probably benign	Het
Pcdhb11	A	T	18: 37,422,381	S255C	possibly damaging	Het
Rrbp1	A	T	2: 143,974,598	C704S	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sh2d3c	C	T	2: 32,752,653	R552*	probably null	Het
Sh3d19	A	G	3: 86,084,911	E82G	probably benign	Het
Son	T	A	16: 91,654,785	L140Q	probably damaging	Het
Syne1	T	C	10: 5,227,912	K4854R	probably benign	Het
Tmem202	C	A	9: 59,525,474		probably benign	Het
Tmem56	T	C	3: 121,207,156	D276G	possibly damaging	Het
Trak2	T	C	1: 58,910,025	T539A	probably benign	Het
Trdn	T	C	10: 33,157,018	S80P	probably damaging	Het
Ugt2b37	T	A	5: 87,254,600	R57S	probably benign	Het
Usp34	G	A	11: 23,458,023	R2616Q	probably damaging	Het
Usp48	T	C	4: 137,638,233	Y113H	probably damaging	Het
Vtcn1	G	T	3: 100,888,163		probably null	Het
Wdr19	G	A	5: 65,225,334	R467Q	possibly damaging	Het
Wdr72	A	G	9: 74,155,039	Y489C	probably benign	Het
Wipf1	C	A	2: 73,437,404	G217W	probably damaging	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8774:Svil	UTSW	18	5049068	missense	not run
R8774-TAIL:Svil	UTSW	18	5049068	missense	not run
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCCATATGGTGTCCTTAGC -3'
(R):5'- GCTGTCAACTGGCTCTTTGATG -3'

Sequencing Primer
(F):5'- CATATGGTGTCCTTAGCTTTGTTC -3'
(R):5'- ACTGGCTCTTTGATGTAGGAAGTAAC -3'

Posted On

2019-05-20