Mutagenetix > Incidental Mutation

Incidental Mutation 'R6915:Dnm3'

554319

Institutional Source

Beutler Lab

Gene Symbol

Dnm3

Ensembl Gene

ENSMUSG00000040265

Gene Name

dynamin 3

Synonyms

B230343F03Rik, 9630020E24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6915 (G1)

Quality Score

75.0075

Status

Validated

Chromosome

Chromosomal Location

161982453-162478034 bp(-) (GRCm38)

Type of Mutation

splice site (184 bp from exon)

DNA Base Change (assembly)

T to C at 162318397 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000083241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000070330

SMART Domains

Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265

Domain	Start	End	E-Value	Type
DYNc	6	245	1.48e-182	SMART
PH	516	623	1.58e-11	SMART
GED	644	735	6.82e-33	SMART
low complexity region	738	751	N/A	INTRINSIC
low complexity region	756	771	N/A	INTRINSIC
low complexity region	799	812	N/A	INTRINSIC
low complexity region	824	852	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000086074

SMART Domains

Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265

Domain	Start	End	E-Value	Type
DYNc	6	245	1.48e-182	SMART
PH	516	623	1.58e-11	SMART
GED	648	739	6.82e-33	SMART
low complexity region	742	755	N/A	INTRINSIC
low complexity region	760	775	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	828	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Akap9	T	A	5: 3,960,551	M436K	probably benign	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lair1	A	T	7: 4,055,953	V12E	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pfas	C	T	11: 68,992,181	R759Q	probably benign	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tinag	T	A	9: 77,001,615	Y348F	probably damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Dnm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Dnm3	APN	1	162011926	missense	probably damaging	1.00
IGL02444:Dnm3	APN	1	162010875	missense	possibly damaging	0.46
IGL02481:Dnm3	APN	1	162010902	missense	probably damaging	0.99
IGL02623:Dnm3	APN	1	162355432	missense	probably damaging	0.99
IGL03132:Dnm3	APN	1	162011105	critical splice acceptor site	probably null
IGL03330:Dnm3	APN	1	162320991	missense	probably benign	0.00
fever	UTSW	1	162321127	splice site	probably null
nobel	UTSW	1	162477705	missense	probably damaging	1.00
splotare	UTSW	1	162320987	missense	probably damaging	0.98
LCD18:Dnm3	UTSW	1	162406561	intron	probably benign
R0066:Dnm3	UTSW	1	162407361	missense	probably damaging	0.98
R0066:Dnm3	UTSW	1	162407361	missense	probably damaging	0.98
R0240:Dnm3	UTSW	1	162353625	missense	probably benign	0.00
R0240:Dnm3	UTSW	1	162353625	missense	probably benign	0.00
R0968:Dnm3	UTSW	1	162019819	splice site	probably benign
R1161:Dnm3	UTSW	1	162353574	missense	probably benign	0.06
R1680:Dnm3	UTSW	1	162010976	missense	probably benign	0.12
R1747:Dnm3	UTSW	1	162313584	missense	probably damaging	1.00
R1881:Dnm3	UTSW	1	162477948	start gained	probably benign
R1997:Dnm3	UTSW	1	162353712	missense	possibly damaging	0.60
R2157:Dnm3	UTSW	1	162307893	missense	possibly damaging	0.95
R2270:Dnm3	UTSW	1	162477789	missense	probably damaging	1.00
R2897:Dnm3	UTSW	1	162286074	splice site	probably benign
R3018:Dnm3	UTSW	1	162321759	nonsense	probably null
R3851:Dnm3	UTSW	1	162321127	splice site	probably null
R3861:Dnm3	UTSW	1	162311405	missense	possibly damaging	0.79
R3930:Dnm3	UTSW	1	162084130	missense	probably damaging	1.00
R4432:Dnm3	UTSW	1	161991997	intron	probably benign
R5318:Dnm3	UTSW	1	162011807	nonsense	probably null
R5361:Dnm3	UTSW	1	162010902	missense	probably damaging	0.99
R5606:Dnm3	UTSW	1	162286018	missense	probably damaging	0.99
R5783:Dnm3	UTSW	1	162355471	missense	possibly damaging	0.70
R6019:Dnm3	UTSW	1	162134501	missense	probably damaging	0.99
R6072:Dnm3	UTSW	1	162011068	small deletion	probably benign
R6086:Dnm3	UTSW	1	162321033	missense	probably damaging	0.99
R6110:Dnm3	UTSW	1	162011068	small deletion	probably benign
R6158:Dnm3	UTSW	1	162320987	missense	probably damaging	0.98
R6473:Dnm3	UTSW	1	162477705	missense	probably damaging	1.00
R6499:Dnm3	UTSW	1	162313595	missense	probably damaging	1.00
R6702:Dnm3	UTSW	1	162318687	missense	probably benign	0.04
R6703:Dnm3	UTSW	1	162318687	missense	probably benign	0.04
R6739:Dnm3	UTSW	1	162477783	missense	probably damaging	0.99
R6811:Dnm3	UTSW	1	162321083	missense	probably damaging	0.96
R6946:Dnm3	UTSW	1	162313655	missense	possibly damaging	0.91
R7062:Dnm3	UTSW	1	162134491	nonsense	probably null
R7067:Dnm3	UTSW	1	162320971	missense	probably damaging	1.00
R7071:Dnm3	UTSW	1	162019843	missense	probably damaging	0.99
R7468:Dnm3	UTSW	1	162321629	splice site	probably null
R7521:Dnm3	UTSW	1	162134544	missense	probably damaging	1.00
R7583:Dnm3	UTSW	1	162477774	missense	possibly damaging	0.93
R7667:Dnm3	UTSW	1	162011830	missense	probably damaging	1.00
R7711:Dnm3	UTSW	1	161992053	missense	possibly damaging	0.83
R7837:Dnm3	UTSW	1	161992050	missense	possibly damaging	0.94
R7838:Dnm3	UTSW	1	161992050	missense	possibly damaging	0.94
R7900:Dnm3	UTSW	1	162355371	missense	probably benign	0.00
R7939:Dnm3	UTSW	1	162295596	missense	possibly damaging	0.91
R8059:Dnm3	UTSW	1	162084139	missense	probably damaging	1.00
R8123:Dnm3	UTSW	1	162011103	missense	probably benign	0.01
R8246:Dnm3	UTSW	1	162307917	missense	probably damaging	1.00
R8249:Dnm3	UTSW	1	162477743	nonsense	probably null
R8511:Dnm3	UTSW	1	162286042	missense	possibly damaging	0.69
R8900:Dnm3	UTSW	1	162307876	missense	probably benign	0.17
R8976:Dnm3	UTSW	1	162307936	missense	probably damaging	1.00
R9455:Dnm3	UTSW	1	162320955	missense	possibly damaging	0.88
R9604:Dnm3	UTSW	1	162011015	missense	possibly damaging	0.55
R9617:Dnm3	UTSW	1	162321785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGGACAAATCATGTGAATATTGG -3'
(R):5'- GCAGCTGCTCTCCATAGAAC -3'

Sequencing Primer
(F):5'- AGAGAGAAAACCCTGCTG -3'
(R):5'- CTGCTCTCCATAGAACATGAAGTGG -3'

Posted On

2019-05-30