Incidental Mutation 'R6915:Gm21738'
ID 554321
Institutional Source Beutler Lab
Gene Symbol Gm21738
Ensembl Gene ENSMUSG00000095280
Gene Name predicted gene, 21738
Synonyms
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R6915 (G1)
Quality Score 47.0072
Status Validated
Chromosome 14
Chromosomal Location (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19415933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 202 (M202T)
Ref Sequence ENSEMBL: ENSMUSP00000137127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177817]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177817
AA Change: M202T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137127
Gene: ENSMUSG00000095280
AA Change: M202T

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.11e-9 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 135 1.11e-9 PROSPERO
transmembrane domain 152 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Gm21738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm21738 APN 14 19,418,885 (GRCm38) missense probably benign
IGL01010:Gm21738 APN 14 19,417,361 (GRCm38) missense probably benign 0.03
IGL01018:Gm21738 APN 14 19,418,856 (GRCm38) missense probably benign 0.39
IGL01865:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01869:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01873:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01877:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01878:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01879:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01880:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01882:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01883:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01884:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01885:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01886:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01888:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01891:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01892:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01893:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01894:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01895:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01896:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01898:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01899:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01900:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01901:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01902:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01903:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01904:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01905:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01906:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01908:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01909:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01910:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01911:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01912:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01913:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01914:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01915:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01916:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01917:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01918:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01919:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01922:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01923:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01924:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01925:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01926:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01932:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01940:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01949:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
PIT4131001:Gm21738 UTSW 14 19,417,330 (GRCm38) missense probably benign 0.00
PIT4142001:Gm21738 UTSW 14 19,417,330 (GRCm38) missense probably benign 0.00
R0831:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R0831:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R0976:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1029:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1146:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1402:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1402:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1638:Gm21738 UTSW 14 19,418,908 (GRCm38) missense probably benign
R1874:Gm21738 UTSW 14 19,418,824 (GRCm38) missense possibly damaging 0.64
R4392:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R4393:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R5049:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R5257:Gm21738 UTSW 14 19,415,942 (GRCm38) missense probably benign
R6756:Gm21738 UTSW 14 19,418,824 (GRCm38) missense possibly damaging 0.64
V5622:Gm21738 UTSW 14 19,417,180 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCGAGAAAACTGAAAATCAC -3'
(R):5'- CAGTTTCTTGGCCATATTCCAGG -3'

Sequencing Primer
(F):5'- CGGAAAATGAGAAATACACACTTTAG -3'
(R):5'- TGGCCATATTCCAGGTACTACAG -3'
Posted On 2019-05-30