Incidental Mutation 'R6983:Bmp1'
ID 554331
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 045090-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6983 (G1)
Quality Score 181.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70745647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 55 (P55T)
Ref Sequence ENSEMBL: ENSMUSP00000154121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226246
AA Change: P192T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000226906
AA Change: P192T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227944
AA Change: P55T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.2489 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,953,686 (GRCm39) V530A probably benign Het
Adgrg6 T C 10: 14,307,439 (GRCm39) N816D probably damaging Het
Aebp2 T C 6: 140,583,389 (GRCm39) F288L possibly damaging Het
Afdn T C 17: 14,101,583 (GRCm39) S1024P probably damaging Het
Akap6 A C 12: 52,934,436 (GRCm39) K643Q probably damaging Het
Atg2a A T 19: 6,310,070 (GRCm39) D1751V probably damaging Het
Best2 T A 8: 85,736,405 (GRCm39) I253F probably benign Het
C1s1 C A 6: 124,517,855 (GRCm39) V42F possibly damaging Het
Ccdc115 A G 1: 34,478,122 (GRCm39) probably null Het
Cdc42bpg C T 19: 6,371,698 (GRCm39) P1326S probably damaging Het
Cdhr3 G A 12: 33,092,379 (GRCm39) T744I probably benign Het
Cit T G 5: 116,132,150 (GRCm39) L1745R probably damaging Het
Commd6 A T 14: 101,874,488 (GRCm39) S39T probably damaging Het
Crot T G 5: 9,028,280 (GRCm39) Y223S probably benign Het
Crybg1 G T 10: 43,875,338 (GRCm39) A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 (GRCm39) E841K probably damaging Het
Dennd4c T C 4: 86,717,730 (GRCm39) Y576H probably damaging Het
Diaph1 A T 18: 38,022,822 (GRCm39) V749E probably damaging Het
Ell2 C A 13: 75,910,006 (GRCm39) L119M probably damaging Het
F5 A T 1: 164,021,698 (GRCm39) D1391V probably damaging Het
Foxf2 T A 13: 31,811,180 (GRCm39) M373K probably benign Het
Fstl1 A T 16: 37,651,980 (GRCm39) E287D probably benign Het
Gltpd2 T C 11: 70,411,110 (GRCm39) Y134H probably damaging Het
Hemgn T A 4: 46,395,997 (GRCm39) H413L possibly damaging Het
Herc2 G A 7: 55,756,201 (GRCm39) R747H possibly damaging Het
Hykk T C 9: 54,853,793 (GRCm39) S372P probably benign Het
Inava A G 1: 136,147,894 (GRCm39) S353P possibly damaging Het
Ints10 T C 8: 69,246,703 (GRCm39) V11A probably damaging Het
Khdrbs1 A G 4: 129,614,635 (GRCm39) V306A probably benign Het
Lamtor2 G A 3: 88,460,146 (GRCm39) Q9* probably null Het
Lonp2 T A 8: 87,350,876 (GRCm39) V22E probably damaging Het
Mad1l1 T C 5: 140,179,739 (GRCm39) E383G probably damaging Het
Man2b1 T A 8: 85,817,700 (GRCm39) probably null Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Myo18a T A 11: 77,736,341 (GRCm39) M1546K probably benign Het
Ntf3 T C 6: 126,078,808 (GRCm39) T233A probably damaging Het
Omg T C 11: 79,392,764 (GRCm39) S365G probably benign Het
Or52ad1 C T 7: 102,996,022 (GRCm39) V38I probably benign Het
Otol1 T A 3: 69,935,374 (GRCm39) N455K probably damaging Het
Pakap T A 4: 57,709,973 (GRCm39) V306D probably damaging Het
Pde4dip A T 3: 97,625,552 (GRCm39) Y1349N probably damaging Het
Pitpnm2 A G 5: 124,271,469 (GRCm39) L368P probably damaging Het
Pnpla8 T A 12: 44,330,030 (GRCm39) I194K possibly damaging Het
Podn T C 4: 107,881,470 (GRCm39) probably null Het
Potefam1 A G 2: 111,058,595 (GRCm39) probably null Het
Pramel6 A T 2: 87,339,923 (GRCm39) E229V possibly damaging Het
Ptpro C T 6: 137,426,915 (GRCm39) P262L probably damaging Het
Rnf122 A T 8: 31,608,488 (GRCm39) T19S probably benign Het
Shank2 T A 7: 143,635,585 (GRCm39) Y320N possibly damaging Het
Slc2a9 A C 5: 38,549,064 (GRCm39) I243S probably damaging Het
Slc5a6 A T 5: 31,197,749 (GRCm39) M130K probably benign Het
Stx5a A G 19: 8,732,533 (GRCm39) probably benign Het
Tbr1 G T 2: 61,642,079 (GRCm39) G185V probably damaging Het
Tg A G 15: 66,565,207 (GRCm39) D1183G probably benign Het
Thbs1 A T 2: 117,950,433 (GRCm39) I689F probably damaging Het
Ticam1 C T 17: 56,576,900 (GRCm39) E732K probably benign Het
Trgv6 G T 13: 19,374,814 (GRCm39) G40W possibly damaging Het
Trub2 A T 2: 29,677,796 (GRCm39) probably benign Het
Ttn A G 2: 76,597,306 (GRCm39) V19869A probably damaging Het
Tufm T C 7: 126,088,607 (GRCm39) V303A possibly damaging Het
Vezf1 T C 11: 87,964,145 (GRCm39) I99T possibly damaging Het
Vmn2r1 T C 3: 63,989,118 (GRCm39) V19A probably benign Het
Xpc C T 6: 91,481,005 (GRCm39) R289K probably damaging Het
Zfp811 T A 17: 33,016,406 (GRCm39) K545* probably null Het
Zmiz2 G A 11: 6,352,413 (GRCm39) D623N probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTGGGATGTGTGTAC -3'
(R):5'- GCATTCTTGCTGCCCCTAAG -3'

Sequencing Primer
(F):5'- TTCTCGCGTACAATAGAGACATGGC -3'
(R):5'- TAAGCTGGGCCTGCCTCTC -3'
Posted On 2019-05-30