Incidental Mutation 'PIT4283001:Olfr1246'
ID554345
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #PIT4283001 (G1)
Quality Score168.009
Status Not validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89590228 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 296 (M296V)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect probably benign
Transcript: ENSMUST00000187990
AA Change: M296V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: M296V

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213221
AA Change: M296V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217192
AA Change: M296V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217254
AA Change: M296V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGTTGATAGTCTCCCGAGTTTAG -3'
(R):5'- ACTTGCAGCTCCCACATCATG -3'

Sequencing Primer
(F):5'- CAGGGCTGATCTTTCTATACTGGAC -3'
(R):5'- TCATGTATGCCAGACCTG -3'
Posted On2019-06-07