Incidental Mutation 'PIT4283001:Dnaaf5'
ID554359
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Namedynein, axonemal assembly factor 5
SynonymsHeatr2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location139150223-139186510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139166162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 523 (T523A)
Ref Sequence ENSEMBL: ENSMUSP00000026975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]
Predicted Effect probably benign
Transcript: ENSMUST00000026975
AA Change: T523A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: T523A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196441
AA Change: T228A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: T228A

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139177946 missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139151668 critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139151480 splice site probably null
IGL02106:Dnaaf5 APN 5 139151513 missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139177916 nonsense probably null
IGL02514:Dnaaf5 APN 5 139174117 splice site probably benign
IGL02572:Dnaaf5 APN 5 139184629 missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139153350 splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139185518 missense possibly damaging 0.91
R0458:Dnaaf5 UTSW 5 139161878 missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139178003 missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139152924 start gained probably benign
R4438:Dnaaf5 UTSW 5 139163392 missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139151527 nonsense probably null
R4576:Dnaaf5 UTSW 5 139185639 missense probably damaging 0.98
R4581:Dnaaf5 UTSW 5 139184685 missense probably damaging 1.00
R4715:Dnaaf5 UTSW 5 139178000 missense probably damaging 0.99
R4791:Dnaaf5 UTSW 5 139184650 missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139170186 missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139163257 missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139174207 missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139181460 missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139161877 missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R5312:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R6632:Dnaaf5 UTSW 5 139170333 missense probably benign 0.04
R6863:Dnaaf5 UTSW 5 139151596 missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139150317 missense unknown
R7439:Dnaaf5 UTSW 5 139166113 missense probably damaging 1.00
R7571:Dnaaf5 UTSW 5 139170208 missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139150637 missense unknown
R7706:Dnaaf5 UTSW 5 139152841 missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
R8191:Dnaaf5 UTSW 5 139181495 missense probably benign 0.06
R8354:Dnaaf5 UTSW 5 139161859 frame shift probably null
R8355:Dnaaf5 UTSW 5 139161859 frame shift probably null
X0020:Dnaaf5 UTSW 5 139163320 missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139177975 missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139185542 missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139185585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTTCTCTGGCTCTTG -3'
(R):5'- CCACCTTGTGAGAGACTCCTTC -3'

Sequencing Primer
(F):5'- CTCTGGCTCTTGCTGCGTG -3'
(R):5'- CCTTTGCTAGTCAAGCCT -3'
Posted On2019-06-07