Incidental Mutation 'PIT4283001:Fuk'
ID554367
Institutional Source Beutler Lab
Gene Symbol Fuk
Ensembl Gene ENSMUSG00000033703
Gene Namefucokinase
SynonymsL-fucose kinase, 1110046B12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #PIT4283001 (G1)
Quality Score87.0076
Status Not validated
Chromosome8
Chromosomal Location110882456-110902488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110887432 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 693 (V693A)
Ref Sequence ENSEMBL: ENSMUSP00000039271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]
Predicted Effect probably benign
Transcript: ENSMUST00000041382
AA Change: V693A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: V693A

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212971
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Fuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Fuk APN 8 110890476 missense possibly damaging 0.75
IGL01963:Fuk APN 8 110893402 missense probably damaging 1.00
IGL01986:Fuk APN 8 110883257 missense probably benign
R0008:Fuk UTSW 8 110884233 splice site probably benign
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0280:Fuk UTSW 8 110894748 missense probably damaging 1.00
R0285:Fuk UTSW 8 110893717 missense probably benign 0.08
R0359:Fuk UTSW 8 110893259 splice site probably null
R0587:Fuk UTSW 8 110883325 missense probably damaging 0.98
R1528:Fuk UTSW 8 110883241 missense probably damaging 1.00
R1731:Fuk UTSW 8 110894823 missense probably damaging 0.96
R1907:Fuk UTSW 8 110893378 nonsense probably null
R2152:Fuk UTSW 8 110889072 missense probably benign 0.03
R2154:Fuk UTSW 8 110889072 missense probably benign 0.03
R2392:Fuk UTSW 8 110889724 missense probably benign
R3037:Fuk UTSW 8 110894718 splice site probably null
R3714:Fuk UTSW 8 110887259 missense probably damaging 1.00
R3765:Fuk UTSW 8 110887104 missense probably benign 0.00
R4307:Fuk UTSW 8 110892080 nonsense probably null
R4404:Fuk UTSW 8 110890301 missense probably benign 0.03
R4768:Fuk UTSW 8 110892134 missense probably benign 0.00
R4998:Fuk UTSW 8 110887803 missense probably damaging 0.96
R5009:Fuk UTSW 8 110887830 missense probably damaging 0.99
R5253:Fuk UTSW 8 110883867 missense possibly damaging 0.90
R6257:Fuk UTSW 8 110890545 missense probably benign 0.00
R6430:Fuk UTSW 8 110884116 missense probably benign 0.16
R6536:Fuk UTSW 8 110883879 missense possibly damaging 0.47
R6599:Fuk UTSW 8 110893283 splice site probably null
R6799:Fuk UTSW 8 110893418 missense probably benign
R7051:Fuk UTSW 8 110890339 missense probably damaging 0.97
R7184:Fuk UTSW 8 110887156 missense probably damaging 1.00
R7241:Fuk UTSW 8 110895897 missense probably benign
R7448:Fuk UTSW 8 110890331 missense possibly damaging 0.93
R8081:Fuk UTSW 8 110889151 missense probably benign
R8094:Fuk UTSW 8 110895972 missense probably damaging 1.00
R8692:Fuk UTSW 8 110889090 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACCAAGCTCATAGGCAATGG -3'
(R):5'- GCCATCTGTGAAAGGATCTCC -3'

Sequencing Primer
(F):5'- CAATGGGCGGTGTGTCACTC -3'
(R):5'- ATCTCCTGATAGTGGATGCTCAGAG -3'
Posted On2019-06-07