Incidental Mutation 'PIT4283001:2610028H24Rik'
ID554372
Institutional Source Beutler Lab
Gene Symbol 2610028H24Rik
Ensembl Gene ENSMUSG00000009114
Gene NameRIKEN cDNA 2610028H24 gene
SynonymsORF67
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location76449081-76461110 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 76449259 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000090061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092406] [ENSMUST00000105415]
Predicted Effect probably benign
Transcript: ENSMUST00000092406
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000090061
Gene: ENSMUSG00000009114
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 94 140 N/A INTRINSIC
Pfam:DUF4587 145 216 7.6e-33 PFAM
low complexity region 223 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105415
SMART Domains Protein: ENSMUSP00000101055
Gene: ENSMUSG00000009114

DomainStartEndE-ValueType
low complexity region 73 119 N/A INTRINSIC
Pfam:DUF4587 124 195 4.4e-34 PFAM
low complexity region 202 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in 2610028H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:2610028H24Rik APN 10 76454810 missense possibly damaging 0.75
IGL02951:2610028H24Rik APN 10 76454702 splice site probably benign
R0013:2610028H24Rik UTSW 10 76457512 missense probably benign 0.32
R0295:2610028H24Rik UTSW 10 76454808 missense probably damaging 0.99
R2018:2610028H24Rik UTSW 10 76458065 missense possibly damaging 0.85
R2019:2610028H24Rik UTSW 10 76458065 missense possibly damaging 0.85
R2128:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R2129:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R4776:2610028H24Rik UTSW 10 76457512 missense probably benign 0.16
R5638:2610028H24Rik UTSW 10 76452895 missense probably benign 0.17
R5808:2610028H24Rik UTSW 10 76450648 missense probably damaging 1.00
R5896:2610028H24Rik UTSW 10 76452830 missense probably benign 0.01
R5990:2610028H24Rik UTSW 10 76449289 missense probably benign 0.08
R6238:2610028H24Rik UTSW 10 76449262 missense possibly damaging 0.86
R6505:2610028H24Rik UTSW 10 76449281 missense probably benign 0.02
R7741:2610028H24Rik UTSW 10 76454717 missense probably damaging 0.99
X0026:2610028H24Rik UTSW 10 76458091 missense possibly damaging 0.91
Z1176:2610028H24Rik UTSW 10 76452863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCACAGGCTAGCAACTG -3'
(R):5'- CTGTTCATTAGGAAGCCAGACG -3'

Sequencing Primer
(F):5'- TAGCAACTGTCACAGACTTCAGGG -3'
(R):5'- CGCAGGGAAAGGGTTTGC -3'
Posted On2019-06-07