Incidental Mutation 'PIT4283001:Eif4enif1'
ID554375
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Nameeukaryotic translation initiation factor 4E nuclear import factor 1
SynonymsD11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location3202392-3244588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3234464 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 528 (E528D)
Ref Sequence ENSEMBL: ENSMUSP00000105676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]
Predicted Effect probably benign
Transcript: ENSMUST00000020734
AA Change: E504D

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: E504D

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110048
AA Change: E504D

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: E504D

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: E528D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: E528D

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120721
AA Change: E353D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: E353D

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135223
SMART Domains Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 1 239 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: E528D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: E528D

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3221143 missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3227876 nonsense probably null
IGL02372:Eif4enif1 APN 11 3229986 missense probably benign 0.09
R0079:Eif4enif1 UTSW 11 3242676 nonsense probably null
R1177:Eif4enif1 UTSW 11 3229902 missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3239493 splice site probably benign
R1511:Eif4enif1 UTSW 11 3236278 missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3215686 missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3227455 missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3243279 missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3242367 splice site probably null
R2215:Eif4enif1 UTSW 11 3227476 missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3221168 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3244003 splice site probably null
R4195:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3220323 missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3244016 missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3242687 missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3243989 missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3242401 missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3242481 missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3227793 missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3240996 missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3242463 missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3234040 missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3215678 missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3220269 missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3227709 nonsense probably null
R7749:Eif4enif1 UTSW 11 3242608 missense probably damaging 0.99
R8381:Eif4enif1 UTSW 11 3227470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAATGGACAGGTGTGTG -3'
(R):5'- ATTCCCTTTGCAAGCTTATGAG -3'

Sequencing Primer
(F):5'- GGGTCCATACTCGAACAATGGC -3'
(R):5'- CCCAAGTCAGTGATGGAGTGTTTAAC -3'
Posted On2019-06-07