Incidental Mutation 'PIT4283001:Morc2b'
ID554384
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33136068 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 910 (H910L)
Ref Sequence ENSEMBL: ENSMUSP00000056879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably benign
Transcript: ENSMUST00000053896
AA Change: H910L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: H910L

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131954
AA Change: H910L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: H910L

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GACCTTGGCTTGTGAGTCAG -3'
(R):5'- ATAGCACACCAAGAGACTGCTG -3'

Sequencing Primer
(F):5'- CAGCACATCTTTGGTAGGAGC -3'
(R):5'- GCTAGTGAAGCCATCTCCAGAG -3'
Posted On2019-06-07