Incidental Mutation 'PIT4283001:Elp2'
ID554385
Institutional Source Beutler Lab
Gene Symbol Elp2
Ensembl Gene ENSMUSG00000024271
Gene Nameelongator acetyltransferase complex subunit 2
SynonymsStatip1, StIP1, Stat3-interacting protein
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location24603961-24638830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24622130 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 392 (D392N)
Ref Sequence ENSEMBL: ENSMUSP00000025120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120]
Predicted Effect probably damaging
Transcript: ENSMUST00000025120
AA Change: D392N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271
AA Change: D392N

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the elongator complex, a histone acetyltransferase complex that associates with RNA polymerase II. In addition to histone acetylation, the encoded protein effects transcriptional elongation and may help remodel chromatin. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Elp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Elp2 APN 18 24617491 missense probably benign 0.01
IGL01909:Elp2 APN 18 24619519 splice site probably benign
IGL01974:Elp2 APN 18 24626203 missense probably damaging 0.99
IGL02243:Elp2 APN 18 24622606 missense probably benign 0.11
IGL03049:Elp2 APN 18 24631459 missense probably benign 0.05
IGL03236:Elp2 APN 18 24622243 splice site probably benign
IGL03380:Elp2 APN 18 24622480 missense probably benign 0.05
Camelid UTSW 18 24625549 missense probably damaging 1.00
PIT4531001:Elp2 UTSW 18 24604113 missense probably damaging 0.99
R0119:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0244:Elp2 UTSW 18 24631471 missense possibly damaging 0.81
R0299:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0609:Elp2 UTSW 18 24626156 missense probably benign
R0671:Elp2 UTSW 18 24612442 splice site probably benign
R1531:Elp2 UTSW 18 24631404 missense probably benign 0.06
R1658:Elp2 UTSW 18 24617413 missense probably benign 0.27
R1673:Elp2 UTSW 18 24611926 missense possibly damaging 0.93
R2012:Elp2 UTSW 18 24631458 missense probably benign 0.00
R3861:Elp2 UTSW 18 24606920 missense probably benign 0.01
R4038:Elp2 UTSW 18 24634348 missense probably damaging 1.00
R4396:Elp2 UTSW 18 24609650 missense probably damaging 1.00
R4507:Elp2 UTSW 18 24626120 splice site probably null
R4901:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R5389:Elp2 UTSW 18 24606903 missense possibly damaging 0.87
R5511:Elp2 UTSW 18 24612450 nonsense probably null
R5633:Elp2 UTSW 18 24615210 missense probably damaging 1.00
R5728:Elp2 UTSW 18 24617452 missense probably damaging 1.00
R6585:Elp2 UTSW 18 24625549 missense probably damaging 1.00
R6855:Elp2 UTSW 18 24606877 missense possibly damaging 0.48
R6877:Elp2 UTSW 18 24634976 missense probably benign 0.00
R7145:Elp2 UTSW 18 24604069 missense probably benign 0.42
R7163:Elp2 UTSW 18 24614446 missense probably benign 0.00
R7313:Elp2 UTSW 18 24609659 missense probably benign 0.05
R7318:Elp2 UTSW 18 24606899 missense probably damaging 1.00
R7403:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R7497:Elp2 UTSW 18 24611928 missense probably damaging 0.96
R8017:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
R8019:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCAAGCTATCTGGCTGCTGG -3'
(R):5'- GGCTACTCACTTGGGAAATGTC -3'

Sequencing Primer
(F):5'- TCAAAGGATACAGCACACATTTGG -3'
(R):5'- TGTCAAGTGGAAGGAAGGCCC -3'
Posted On2019-06-07