Incidental Mutation 'PIT4280001:Mms22l'
ID554400
Institutional Source Beutler Lab
Gene Symbol Mms22l
Ensembl Gene ENSMUSG00000045751
Gene NameMMS22-like, DNA repair protein
SynonymsF730047E07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4280001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location24496451-24602950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24581149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 820 (T820A)
Ref Sequence ENSEMBL: ENSMUSP00000057715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222]
Predicted Effect probably benign
Transcript: ENSMUST00000050446
AA Change: T820A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: T820A

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 395 1.1e-199 PFAM
Pfam:MMS22L_N 392 690 4.6e-155 PFAM
low complexity region 698 711 N/A INTRINSIC
low complexity region 761 770 N/A INTRINSIC
Pfam:MMS22L_C 809 1186 2.3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108222
AA Change: T860A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: T860A

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 730 N/A PFAM
low complexity region 738 751 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:MMS22L_C 849 1225 1.4e-142 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751
AA Change: T588A

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 459 1.3e-239 PFAM
low complexity region 467 480 N/A INTRINSIC
low complexity region 530 539 N/A INTRINSIC
Pfam:MMS22L_C 578 733 1.9e-58 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.9%
  • 10x: 85.5%
  • 20x: 73.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,440,834 D161G probably damaging Het
2810474O19Rik T G 6: 149,325,525 I23S probably benign Het
Acer2 C T 4: 86,887,083 L95F probably damaging Het
Adam15 C T 3: 89,343,978 probably null Het
Bmi1 T A 2: 18,683,009 Y98* probably null Het
Cdon T C 9: 35,486,935 C983R probably damaging Het
Col12a1 T C 9: 79,678,105 R1297G probably damaging Het
Cpd A T 11: 76,791,024 M1132K probably benign Het
Dnah17 T A 11: 118,098,582 R1267W possibly damaging Het
Dnah9 G A 11: 66,005,013 A2512V probably benign Het
Eri3 G A 4: 117,582,634 G175D probably damaging Het
Fbxo9 C A 9: 78,087,511 W244L probably damaging Het
Fgfr3 A T 5: 33,732,232 H343L probably benign Het
Fmnl2 G A 2: 53,118,196 A803T unknown Het
Fmnl3 A G 15: 99,321,253 probably null Het
Fth1 C A 19: 9,984,609 A104E probably damaging Het
Gcm1 T C 9: 78,059,633 Y45H probably damaging Het
Gm5157 C G 7: 21,185,082 G179R probably damaging Het
Gpr179 A G 11: 97,344,115 I463T probably damaging Het
Gpr35 T C 1: 92,982,634 Y23H probably damaging Het
Inpp4b C T 8: 82,034,417 H647Y probably benign Het
Kif6 A T 17: 49,755,120 K436M probably benign Het
Lacc1 T A 14: 77,035,077 Q93L probably damaging Het
Lamc1 T C 1: 153,243,471 R801G probably damaging Het
Lrp2bp T G 8: 46,023,011 V263G probably damaging Het
Maats1 C T 16: 38,332,773 V160I probably benign Het
Magi3 T A 3: 104,054,352 K453N probably damaging Het
Mfsd6 T A 1: 52,660,880 Y703F probably benign Het
Ndufa12 T C 10: 94,199,132 probably null Het
Nlrp12 A T 7: 3,241,433 C150S possibly damaging Het
Noc4l G A 5: 110,651,439 T159I probably benign Het
Olfml2b T A 1: 170,647,736 C77S probably damaging Het
Olfr1259 A T 2: 89,943,743 I124N probably damaging Het
Olfr460 C A 6: 40,571,716 T110K probably damaging Het
Pdzd2 A G 15: 12,399,288 V784A probably damaging Het
Pip5kl1 A T 2: 32,583,458 Y369F probably benign Het
Pkdrej A T 15: 85,819,935 I600N probably benign Het
Psg19 T C 7: 18,796,906 I108V probably damaging Het
Pxdn G A 12: 29,995,328 V539M probably damaging Het
Rsbn1l T A 5: 20,919,655 H383L probably damaging Het
Scamp2 A T 9: 57,580,793 N118I probably damaging Het
Scn2a T C 2: 65,715,730 V879A probably damaging Het
Scn8a G A 15: 100,957,489 E172K probably damaging Het
Slc16a6 C T 11: 109,458,593 C214Y possibly damaging Het
Stag1 A G 9: 100,942,716 T922A possibly damaging Het
Svs1 A T 6: 48,987,120 M21L probably benign Het
Tarbp1 T C 8: 126,430,847 H1307R probably damaging Het
Tut1 T G 19: 8,959,262 V150G probably benign Het
Ubr2 G A 17: 46,944,863 R1371W probably damaging Het
Vmn2r124 A G 17: 18,063,225 N394D probably benign Het
Vmn2r63 T C 7: 42,903,985 T616A probably damaging Het
Zp3 G A 5: 135,984,464 V217M possibly damaging Het
Other mutations in Mms22l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Mms22l APN 4 24502805 missense probably damaging 1.00
IGL02158:Mms22l APN 4 24505349 missense probably damaging 0.98
IGL02533:Mms22l APN 4 24581099 splice site probably benign
IGL02612:Mms22l APN 4 24508482 missense probably benign 0.03
IGL02685:Mms22l APN 4 24591133 missense probably benign
IGL03000:Mms22l APN 4 24581161 missense probably damaging 0.99
IGL03006:Mms22l APN 4 24521253 missense probably damaging 1.00
R0157:Mms22l UTSW 4 24588224 missense probably damaging 1.00
R0279:Mms22l UTSW 4 24497867 missense probably damaging 1.00
R0669:Mms22l UTSW 4 24517223 missense probably benign 0.00
R1056:Mms22l UTSW 4 24586344 critical splice donor site probably null
R1232:Mms22l UTSW 4 24536274 missense probably benign 0.24
R1389:Mms22l UTSW 4 24591076 missense probably damaging 1.00
R1543:Mms22l UTSW 4 24591084 missense probably benign 0.41
R1604:Mms22l UTSW 4 24502804 missense probably damaging 1.00
R1872:Mms22l UTSW 4 24598807 missense probably damaging 0.99
R1929:Mms22l UTSW 4 24535936 unclassified probably benign
R2024:Mms22l UTSW 4 24588365 missense probably damaging 1.00
R2081:Mms22l UTSW 4 24536150 missense probably damaging 1.00
R2104:Mms22l UTSW 4 24591084 missense probably benign 0.41
R2147:Mms22l UTSW 4 24580063 nonsense probably null
R2379:Mms22l UTSW 4 24496929 missense possibly damaging 0.87
R2496:Mms22l UTSW 4 24521269 missense probably benign 0.31
R3508:Mms22l UTSW 4 24586224 missense probably benign 0.01
R3625:Mms22l UTSW 4 24505357 missense probably damaging 1.00
R3789:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R4422:Mms22l UTSW 4 24503008 missense probably damaging 1.00
R4623:Mms22l UTSW 4 24502792 nonsense probably null
R4799:Mms22l UTSW 4 24580052 critical splice acceptor site probably null
R4825:Mms22l UTSW 4 24536226 missense probably damaging 1.00
R5236:Mms22l UTSW 4 24588347 missense probably benign 0.02
R5276:Mms22l UTSW 4 24578774 missense probably damaging 1.00
R5364:Mms22l UTSW 4 24496882 unclassified probably benign
R5394:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R6905:Mms22l UTSW 4 24503107 missense probably benign 0.00
R7206:Mms22l UTSW 4 24591146 missense probably benign 0.00
R7290:Mms22l UTSW 4 24517139 missense probably benign
R7425:Mms22l UTSW 4 24596287 missense probably benign 0.15
R7524:Mms22l UTSW 4 24536138 missense possibly damaging 0.89
R7536:Mms22l UTSW 4 24581240 missense probably damaging 0.99
R7722:Mms22l UTSW 4 24517201 missense probably damaging 1.00
R7757:Mms22l UTSW 4 24598884 critical splice donor site probably null
R7764:Mms22l UTSW 4 24598842 missense probably damaging 1.00
RF005:Mms22l UTSW 4 24517207 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGGCCTGAGAAGGTTGTACTTC -3'
(R):5'- GAGAGCAACACTTCCTTTACTCC -3'

Sequencing Primer
(F):5'- GCCTCAATACATTTTTGAGGTTAGG -3'
(R):5'- GGCAACTAACGATATGACTTGTTAAG -3'
Posted On2019-06-07