Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4280001:Tarbp1'

554416

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4280001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126430847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1307 (H1307R)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

probably damaging
Transcript: ENSMUST00000170518
AA Change: H1307R

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: H1307R

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Coding Region Coverage

1x: 93.1%
3x: 90.9%
10x: 85.5%
20x: 73.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	A	G	11: 83,440,834	D161G	probably damaging	Het
2810474O19Rik	T	G	6: 149,325,525	I23S	probably benign	Het
Acer2	C	T	4: 86,887,083	L95F	probably damaging	Het
Adam15	C	T	3: 89,343,978		probably null	Het
Bmi1	T	A	2: 18,683,009	Y98*	probably null	Het
Cdon	T	C	9: 35,486,935	C983R	probably damaging	Het
Col12a1	T	C	9: 79,678,105	R1297G	probably damaging	Het
Cpd	A	T	11: 76,791,024	M1132K	probably benign	Het
Dnah17	T	A	11: 118,098,582	R1267W	possibly damaging	Het
Dnah9	G	A	11: 66,005,013	A2512V	probably benign	Het
Eri3	G	A	4: 117,582,634	G175D	probably damaging	Het
Fbxo9	C	A	9: 78,087,511	W244L	probably damaging	Het
Fgfr3	A	T	5: 33,732,232	H343L	probably benign	Het
Fmnl2	G	A	2: 53,118,196	A803T	unknown	Het
Fmnl3	A	G	15: 99,321,253		probably null	Het
Fth1	C	A	19: 9,984,609	A104E	probably damaging	Het
Gcm1	T	C	9: 78,059,633	Y45H	probably damaging	Het
Gm5157	C	G	7: 21,185,082	G179R	probably damaging	Het
Gpr179	A	G	11: 97,344,115	I463T	probably damaging	Het
Gpr35	T	C	1: 92,982,634	Y23H	probably damaging	Het
Inpp4b	C	T	8: 82,034,417	H647Y	probably benign	Het
Kif6	A	T	17: 49,755,120	K436M	probably benign	Het
Lacc1	T	A	14: 77,035,077	Q93L	probably damaging	Het
Lamc1	T	C	1: 153,243,471	R801G	probably damaging	Het
Lrp2bp	T	G	8: 46,023,011	V263G	probably damaging	Het
Maats1	C	T	16: 38,332,773	V160I	probably benign	Het
Magi3	T	A	3: 104,054,352	K453N	probably damaging	Het
Mfsd6	T	A	1: 52,660,880	Y703F	probably benign	Het
Mms22l	A	G	4: 24,581,149	T820A	probably benign	Het
Ndufa12	T	C	10: 94,199,132		probably null	Het
Nlrp12	A	T	7: 3,241,433	C150S	possibly damaging	Het
Noc4l	G	A	5: 110,651,439	T159I	probably benign	Het
Olfml2b	T	A	1: 170,647,736	C77S	probably damaging	Het
Olfr1259	A	T	2: 89,943,743	I124N	probably damaging	Het
Olfr460	C	A	6: 40,571,716	T110K	probably damaging	Het
Pdzd2	A	G	15: 12,399,288	V784A	probably damaging	Het
Pip5kl1	A	T	2: 32,583,458	Y369F	probably benign	Het
Pkdrej	A	T	15: 85,819,935	I600N	probably benign	Het
Psg19	T	C	7: 18,796,906	I108V	probably damaging	Het
Pxdn	G	A	12: 29,995,328	V539M	probably damaging	Het
Rsbn1l	T	A	5: 20,919,655	H383L	probably damaging	Het
Scamp2	A	T	9: 57,580,793	N118I	probably damaging	Het
Scn2a	T	C	2: 65,715,730	V879A	probably damaging	Het
Scn8a	G	A	15: 100,957,489	E172K	probably damaging	Het
Slc16a6	C	T	11: 109,458,593	C214Y	possibly damaging	Het
Stag1	A	G	9: 100,942,716	T922A	possibly damaging	Het
Svs1	A	T	6: 48,987,120	M21L	probably benign	Het
Tut1	T	G	19: 8,959,262	V150G	probably benign	Het
Ubr2	G	A	17: 46,944,863	R1371W	probably damaging	Het
Vmn2r124	A	G	17: 18,063,225	N394D	probably benign	Het
Vmn2r63	T	C	7: 42,903,985	T616A	probably damaging	Het
Zp3	G	A	5: 135,984,464	V217M	possibly damaging	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTACAAGCCAGACACTGCC -3'
(R):5'- GGCAGAACTAGAACATACATACCTT -3'

Sequencing Primer
(F):5'- GAAATGACTAGCCAGTTGTCAC -3'
(R):5'- ACCTTAATGTTGGAGAGTATGGAC -3'

Posted On

2019-06-07