Incidental Mutation 'PIT4280001:Ndufa12'
ID554423
Institutional Source Beutler Lab
Gene Symbol Ndufa12
Ensembl Gene ENSMUSG00000020022
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4280001 (G1)
Quality Score126.008
Status Not validated
Chromosome10
Chromosomal Location94198720-94221443 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94199132 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020209] [ENSMUST00000092213] [ENSMUST00000099343] [ENSMUST00000105290] [ENSMUST00000135292] [ENSMUST00000179990]
Predicted Effect probably null
Transcript: ENSMUST00000020209
SMART Domains Protein: ENSMUSP00000020209
Gene: ENSMUSG00000020022

DomainStartEndE-ValueType
Pfam:NDUFA12 36 141 2.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092213
SMART Domains Protein: ENSMUSP00000089858
Gene: ENSMUSG00000005897

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099343
SMART Domains Protein: ENSMUSP00000096945
Gene: ENSMUSG00000005897

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105290
SMART Domains Protein: ENSMUSP00000100927
Gene: ENSMUSG00000005897

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135292
SMART Domains Protein: ENSMUSP00000119625
Gene: ENSMUSG00000020022

DomainStartEndE-ValueType
Pfam:NDUFA12 36 85 1.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179990
SMART Domains Protein: ENSMUSP00000136313
Gene: ENSMUSG00000020022

DomainStartEndE-ValueType
Pfam:NDUFA12 40 143 1.4e-32 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.9%
  • 10x: 85.5%
  • 20x: 73.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,440,834 D161G probably damaging Het
2810474O19Rik T G 6: 149,325,525 I23S probably benign Het
Acer2 C T 4: 86,887,083 L95F probably damaging Het
Adam15 C T 3: 89,343,978 probably null Het
Bmi1 T A 2: 18,683,009 Y98* probably null Het
Cdon T C 9: 35,486,935 C983R probably damaging Het
Col12a1 T C 9: 79,678,105 R1297G probably damaging Het
Cpd A T 11: 76,791,024 M1132K probably benign Het
Dnah17 T A 11: 118,098,582 R1267W possibly damaging Het
Dnah9 G A 11: 66,005,013 A2512V probably benign Het
Eri3 G A 4: 117,582,634 G175D probably damaging Het
Fbxo9 C A 9: 78,087,511 W244L probably damaging Het
Fgfr3 A T 5: 33,732,232 H343L probably benign Het
Fmnl2 G A 2: 53,118,196 A803T unknown Het
Fmnl3 A G 15: 99,321,253 probably null Het
Fth1 C A 19: 9,984,609 A104E probably damaging Het
Gcm1 T C 9: 78,059,633 Y45H probably damaging Het
Gm5157 C G 7: 21,185,082 G179R probably damaging Het
Gpr179 A G 11: 97,344,115 I463T probably damaging Het
Gpr35 T C 1: 92,982,634 Y23H probably damaging Het
Inpp4b C T 8: 82,034,417 H647Y probably benign Het
Kif6 A T 17: 49,755,120 K436M probably benign Het
Lacc1 T A 14: 77,035,077 Q93L probably damaging Het
Lamc1 T C 1: 153,243,471 R801G probably damaging Het
Lrp2bp T G 8: 46,023,011 V263G probably damaging Het
Maats1 C T 16: 38,332,773 V160I probably benign Het
Magi3 T A 3: 104,054,352 K453N probably damaging Het
Mfsd6 T A 1: 52,660,880 Y703F probably benign Het
Mms22l A G 4: 24,581,149 T820A probably benign Het
Nlrp12 A T 7: 3,241,433 C150S possibly damaging Het
Noc4l G A 5: 110,651,439 T159I probably benign Het
Olfml2b T A 1: 170,647,736 C77S probably damaging Het
Olfr1259 A T 2: 89,943,743 I124N probably damaging Het
Olfr460 C A 6: 40,571,716 T110K probably damaging Het
Pdzd2 A G 15: 12,399,288 V784A probably damaging Het
Pip5kl1 A T 2: 32,583,458 Y369F probably benign Het
Pkdrej A T 15: 85,819,935 I600N probably benign Het
Psg19 T C 7: 18,796,906 I108V probably damaging Het
Pxdn G A 12: 29,995,328 V539M probably damaging Het
Rsbn1l T A 5: 20,919,655 H383L probably damaging Het
Scamp2 A T 9: 57,580,793 N118I probably damaging Het
Scn2a T C 2: 65,715,730 V879A probably damaging Het
Scn8a G A 15: 100,957,489 E172K probably damaging Het
Slc16a6 C T 11: 109,458,593 C214Y possibly damaging Het
Stag1 A G 9: 100,942,716 T922A possibly damaging Het
Svs1 A T 6: 48,987,120 M21L probably benign Het
Tarbp1 T C 8: 126,430,847 H1307R probably damaging Het
Tut1 T G 19: 8,959,262 V150G probably benign Het
Ubr2 G A 17: 46,944,863 R1371W probably damaging Het
Vmn2r124 A G 17: 18,063,225 N394D probably benign Het
Vmn2r63 T C 7: 42,903,985 T616A probably damaging Het
Zp3 G A 5: 135,984,464 V217M possibly damaging Het
Other mutations in Ndufa12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1455:Ndufa12 UTSW 10 94203314 missense probably benign 0.22
R1700:Ndufa12 UTSW 10 94199993 missense probably damaging 0.99
R2067:Ndufa12 UTSW 10 94220707 missense probably damaging 0.99
R4457:Ndufa12 UTSW 10 94220818 missense probably damaging 1.00
R4790:Ndufa12 UTSW 10 94220758 missense probably benign 0.02
R7603:Ndufa12 UTSW 10 94220779 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTAGGAAGACACCAACCTGTACTG -3'
(R):5'- ATTACACCCCAGGACTCGAG -3'

Sequencing Primer
(F):5'- AGATAATCCTCCCTGCGCG -3'
(R):5'- TAGCACCTGCGTCACAGCTC -3'
Posted On2019-06-07