Incidental Mutation 'PIT4280001:Pxdn'
ID 554430
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Name peroxidasin
Synonyms VPO1, 2310075M15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock # PIT4280001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 29937608-30017658 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 29995328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 539 (V539M)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
AlphaFold Q3UQ28
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: V539M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: V539M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: V359M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.9%
  • 10x: 85.5%
  • 20x: 73.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,440,834 D161G probably damaging Het
2810474O19Rik T G 6: 149,325,525 I23S probably benign Het
Acer2 C T 4: 86,887,083 L95F probably damaging Het
Adam15 C T 3: 89,343,978 probably null Het
Bmi1 T A 2: 18,683,009 Y98* probably null Het
Cdon T C 9: 35,486,935 C983R probably damaging Het
Col12a1 T C 9: 79,678,105 R1297G probably damaging Het
Cpd A T 11: 76,791,024 M1132K probably benign Het
Dnah17 T A 11: 118,098,582 R1267W possibly damaging Het
Dnah9 G A 11: 66,005,013 A2512V probably benign Het
Eri3 G A 4: 117,582,634 G175D probably damaging Het
Fbxo9 C A 9: 78,087,511 W244L probably damaging Het
Fgfr3 A T 5: 33,732,232 H343L probably benign Het
Fmnl2 G A 2: 53,118,196 A803T unknown Het
Fmnl3 A G 15: 99,321,253 probably null Het
Fth1 C A 19: 9,984,609 A104E probably damaging Het
Gcm1 T C 9: 78,059,633 Y45H probably damaging Het
Gm5157 C G 7: 21,185,082 G179R probably damaging Het
Gpr179 A G 11: 97,344,115 I463T probably damaging Het
Gpr35 T C 1: 92,982,634 Y23H probably damaging Het
Inpp4b C T 8: 82,034,417 H647Y probably benign Het
Kif6 A T 17: 49,755,120 K436M probably benign Het
Lacc1 T A 14: 77,035,077 Q93L probably damaging Het
Lamc1 T C 1: 153,243,471 R801G probably damaging Het
Lrp2bp T G 8: 46,023,011 V263G probably damaging Het
Maats1 C T 16: 38,332,773 V160I probably benign Het
Magi3 T A 3: 104,054,352 K453N probably damaging Het
Mfsd6 T A 1: 52,660,880 Y703F probably benign Het
Mms22l A G 4: 24,581,149 T820A probably benign Het
Ndufa12 T C 10: 94,199,132 probably null Het
Nlrp12 A T 7: 3,241,433 C150S possibly damaging Het
Noc4l G A 5: 110,651,439 T159I probably benign Het
Olfml2b T A 1: 170,647,736 C77S probably damaging Het
Olfr1259 A T 2: 89,943,743 I124N probably damaging Het
Olfr460 C A 6: 40,571,716 T110K probably damaging Het
Pdzd2 A G 15: 12,399,288 V784A probably damaging Het
Pip5kl1 A T 2: 32,583,458 Y369F probably benign Het
Pkdrej A T 15: 85,819,935 I600N probably benign Het
Psg19 T C 7: 18,796,906 I108V probably damaging Het
Rsbn1l T A 5: 20,919,655 H383L probably damaging Het
Scamp2 A T 9: 57,580,793 N118I probably damaging Het
Scn2a T C 2: 65,715,730 V879A probably damaging Het
Scn8a G A 15: 100,957,489 E172K probably damaging Het
Slc16a6 C T 11: 109,458,593 C214Y possibly damaging Het
Stag1 A G 9: 100,942,716 T922A possibly damaging Het
Svs1 A T 6: 48,987,120 M21L probably benign Het
Tarbp1 T C 8: 126,430,847 H1307R probably damaging Het
Tut1 T G 19: 8,959,262 V150G probably benign Het
Ubr2 G A 17: 46,944,863 R1371W probably damaging Het
Vmn2r124 A G 17: 18,063,225 N394D probably benign Het
Vmn2r63 T C 7: 42,903,985 T616A probably damaging Het
Zp3 G A 5: 135,984,464 V217M possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
R8903:Pxdn UTSW 12 29990993 missense probably benign
R9310:Pxdn UTSW 12 30002052 missense probably damaging 1.00
R9487:Pxdn UTSW 12 29994553 missense possibly damaging 0.90
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAATCCAGTTCAGTTGCG -3'
(R):5'- AAAGGACTTTCTTTGCTTCTGATGC -3'

Sequencing Primer
(F):5'- CAGTTCAGTTGCGGGGCTC -3'
(R):5'- GGCAGATCTCTAAGTTCAAGGCC -3'
Posted On 2019-06-07