Incidental Mutation 'PIT4280001:Maats1'
ID554436
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4280001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38332773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 160 (V160I)
Ref Sequence ENSEMBL: ENSMUSP00000023501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect probably benign
Transcript: ENSMUST00000023501
AA Change: V160I

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: V160I

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114740
AA Change: V160I

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: V160I

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.9%
  • 10x: 85.5%
  • 20x: 73.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,440,834 D161G probably damaging Het
2810474O19Rik T G 6: 149,325,525 I23S probably benign Het
Acer2 C T 4: 86,887,083 L95F probably damaging Het
Adam15 C T 3: 89,343,978 probably null Het
Bmi1 T A 2: 18,683,009 Y98* probably null Het
Cdon T C 9: 35,486,935 C983R probably damaging Het
Col12a1 T C 9: 79,678,105 R1297G probably damaging Het
Cpd A T 11: 76,791,024 M1132K probably benign Het
Dnah17 T A 11: 118,098,582 R1267W possibly damaging Het
Dnah9 G A 11: 66,005,013 A2512V probably benign Het
Eri3 G A 4: 117,582,634 G175D probably damaging Het
Fbxo9 C A 9: 78,087,511 W244L probably damaging Het
Fgfr3 A T 5: 33,732,232 H343L probably benign Het
Fmnl2 G A 2: 53,118,196 A803T unknown Het
Fmnl3 A G 15: 99,321,253 probably null Het
Fth1 C A 19: 9,984,609 A104E probably damaging Het
Gcm1 T C 9: 78,059,633 Y45H probably damaging Het
Gm5157 C G 7: 21,185,082 G179R probably damaging Het
Gpr179 A G 11: 97,344,115 I463T probably damaging Het
Gpr35 T C 1: 92,982,634 Y23H probably damaging Het
Inpp4b C T 8: 82,034,417 H647Y probably benign Het
Kif6 A T 17: 49,755,120 K436M probably benign Het
Lacc1 T A 14: 77,035,077 Q93L probably damaging Het
Lamc1 T C 1: 153,243,471 R801G probably damaging Het
Lrp2bp T G 8: 46,023,011 V263G probably damaging Het
Magi3 T A 3: 104,054,352 K453N probably damaging Het
Mfsd6 T A 1: 52,660,880 Y703F probably benign Het
Mms22l A G 4: 24,581,149 T820A probably benign Het
Ndufa12 T C 10: 94,199,132 probably null Het
Nlrp12 A T 7: 3,241,433 C150S possibly damaging Het
Noc4l G A 5: 110,651,439 T159I probably benign Het
Olfml2b T A 1: 170,647,736 C77S probably damaging Het
Olfr1259 A T 2: 89,943,743 I124N probably damaging Het
Olfr460 C A 6: 40,571,716 T110K probably damaging Het
Pdzd2 A G 15: 12,399,288 V784A probably damaging Het
Pip5kl1 A T 2: 32,583,458 Y369F probably benign Het
Pkdrej A T 15: 85,819,935 I600N probably benign Het
Psg19 T C 7: 18,796,906 I108V probably damaging Het
Pxdn G A 12: 29,995,328 V539M probably damaging Het
Rsbn1l T A 5: 20,919,655 H383L probably damaging Het
Scamp2 A T 9: 57,580,793 N118I probably damaging Het
Scn2a T C 2: 65,715,730 V879A probably damaging Het
Scn8a G A 15: 100,957,489 E172K probably damaging Het
Slc16a6 C T 11: 109,458,593 C214Y possibly damaging Het
Stag1 A G 9: 100,942,716 T922A possibly damaging Het
Svs1 A T 6: 48,987,120 M21L probably benign Het
Tarbp1 T C 8: 126,430,847 H1307R probably damaging Het
Tut1 T G 19: 8,959,262 V150G probably benign Het
Ubr2 G A 17: 46,944,863 R1371W probably damaging Het
Vmn2r124 A G 17: 18,063,225 N394D probably benign Het
Vmn2r63 T C 7: 42,903,985 T616A probably damaging Het
Zp3 G A 5: 135,984,464 V217M possibly damaging Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4449001:Maats1 UTSW 16 38328358 missense probably damaging 1.00
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1693:Maats1 UTSW 16 38341723 missense probably benign
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4493:Maats1 UTSW 16 38341768 missense probably benign 0.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6165:Maats1 UTSW 16 38333811 missense possibly damaging 0.93
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7271:Maats1 UTSW 16 38328346 missense probably damaging 1.00
R7325:Maats1 UTSW 16 38321601 intron probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TAATACCCAGACCTTGGCATAC -3'
(R):5'- ACAGCTGGACGTTTGCATC -3'

Sequencing Primer
(F):5'- TTGGCATACAGAAAAATCACCAGAG -3'
(R):5'- GCGAGCCAGTATGAAAAC -3'
Posted On2019-06-07