Incidental Mutation 'PIT4243001:Accs'
ID554444
Institutional Source Beutler Lab
Gene Symbol Accs
Ensembl Gene ENSMUSG00000040272
Gene Name1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms2610203E10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #PIT4243001 (G1)
Quality Score152.008
Status Not validated
Chromosome2
Chromosomal Location93833467-93849943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93841334 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 237 (M237T)
Ref Sequence ENSEMBL: ENSMUSP00000106877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041593] [ENSMUST00000068513] [ENSMUST00000111246] [ENSMUST00000130077]
Predicted Effect probably benign
Transcript: ENSMUST00000041593
AA Change: M214T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036268
Gene: ENSMUSG00000040272
AA Change: M214T

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068513
AA Change: M214T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065389
Gene: ENSMUSG00000040272
AA Change: M214T

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111246
AA Change: M237T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106877
Gene: ENSMUSG00000040272
AA Change: M237T

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:Aminotran_1_2 97 471 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130077
SMART Domains Protein: ENSMUSP00000114687
Gene: ENSMUSG00000040272

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 157 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150666
SMART Domains Protein: ENSMUSP00000119096
Gene: ENSMUSG00000040272

DomainStartEndE-ValueType
SCOP:d1b8ga_ 2 72 7e-9 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 85.2%
  • 20x: 74.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,140 E252V possibly damaging Het
Abhd13 T C 8: 9,987,967 F188S possibly damaging Het
Abtb1 A G 6: 88,838,726 V225A probably benign Het
Adcy9 A G 16: 4,418,407 I380T probably damaging Het
Add3 T C 19: 53,236,690 S414P probably benign Het
Ak3 C T 19: 29,037,871 probably null Het
Atg14 T C 14: 47,554,574 E132G possibly damaging Het
Bcl2l11 A G 2: 128,147,106 E135G probably benign Het
Brwd1 G A 16: 96,002,671 Q2100* probably null Het
Card11 A C 5: 140,908,604 V90G possibly damaging Het
Celsr3 T C 9: 108,832,308 V1451A probably benign Het
Clip4 T C 17: 71,806,728 I291T probably damaging Het
Clk1 C T 1: 58,419,677 D179N probably damaging Het
Cyp11b2 A G 15: 74,851,453 L454P probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Ep400 A G 5: 110,735,580 S663P unknown Het
Erich6 G A 3: 58,629,879 T238I possibly damaging Het
Herc1 T A 9: 66,372,207 H132Q probably benign Het
Hk2 A G 6: 82,730,877 C704R probably damaging Het
Ift74 A T 4: 94,686,904 R531W possibly damaging Het
Ism2 T C 12: 87,287,058 E71G probably benign Het
Lipe A C 7: 25,395,546 S22A probably benign Het
Myl10 A G 5: 136,694,293 D32G probably benign Het
Nomo1 A G 7: 46,044,281 H179R probably damaging Het
Olfr133 T C 17: 38,149,503 F305S probably benign Het
Olfr1378 T C 11: 50,969,552 F178S probably damaging Het
Pdpn T A 4: 143,270,538 T129S probably damaging Het
Pold1 C T 7: 44,542,158 V135I possibly damaging Het
Rasgrp3 T A 17: 75,500,139 N199K probably damaging Het
Skil T C 3: 31,113,565 S449P probably damaging Het
Spag16 T C 1: 69,853,381 L107P probably damaging Het
Tbccd1 A G 16: 22,822,337 M430T probably damaging Het
Tnfaip3 G A 10: 19,011,574 L68F probably damaging Het
Trrap G A 5: 144,796,971 R878H probably benign Het
Vasn T C 16: 4,649,616 S476P probably damaging Het
Vmn2r110 T A 17: 20,582,117 M499L probably benign Het
Wwp1 T C 4: 19,638,631 T571A probably damaging Het
Zfp608 C A 18: 54,898,024 G948V probably damaging Het
Zswim5 A G 4: 116,984,778 I852V probably benign Het
Other mutations in Accs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Accs APN 2 93839242 splice site probably benign
IGL02704:Accs APN 2 93842926 missense probably damaging 0.99
IGL02724:Accs APN 2 93845776 missense probably damaging 1.00
IGL02929:Accs APN 2 93844221 missense probably damaging 1.00
R0043:Accs UTSW 2 93841885 missense probably benign 0.03
R0644:Accs UTSW 2 93839229 missense probably damaging 1.00
R1712:Accs UTSW 2 93848103 missense probably damaging 0.96
R2215:Accs UTSW 2 93841898 missense probably benign 0.00
R4755:Accs UTSW 2 93841337 missense probably damaging 1.00
R4852:Accs UTSW 2 93844260 missense probably damaging 1.00
R4997:Accs UTSW 2 93841883 nonsense probably null
R5287:Accs UTSW 2 93835953 missense probably damaging 1.00
R5556:Accs UTSW 2 93836083 missense probably damaging 1.00
R5760:Accs UTSW 2 93845760 missense probably damaging 1.00
R5942:Accs UTSW 2 93836047 missense probably damaging 1.00
R5972:Accs UTSW 2 93839227 missense probably damaging 1.00
R6820:Accs UTSW 2 93842921 missense probably null 1.00
R7513:Accs UTSW 2 93840092 missense possibly damaging 0.94
R7861:Accs UTSW 2 93835732 makesense probably null
R7947:Accs UTSW 2 93844257 missense probably damaging 1.00
R8038:Accs UTSW 2 93842917 critical splice donor site probably null
R8404:Accs UTSW 2 93838115 missense probably damaging 1.00
R8502:Accs UTSW 2 93838115 missense probably damaging 1.00
Z1177:Accs UTSW 2 93848153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCGAAGGCCCTCCATAG -3'
(R):5'- CAGGAAAGGGAAGCAGTCCTTC -3'

Sequencing Primer
(F):5'- GGCCCTCCATAGATACAGGATTCTG -3'
(R):5'- GAAGCAGTCCTTCCTGTTTTTCAGAG -3'
Posted On2019-06-07