Incidental Mutation 'PIT4243001:Wwp1'
ID554448
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4243001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19638631 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 571 (T571A)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035982
AA Change: T571A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: T571A

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108246
AA Change: T571A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: T571A

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 85.2%
  • 20x: 74.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,140 E252V possibly damaging Het
Abhd13 T C 8: 9,987,967 F188S possibly damaging Het
Abtb1 A G 6: 88,838,726 V225A probably benign Het
Accs A G 2: 93,841,334 M237T probably benign Het
Adcy9 A G 16: 4,418,407 I380T probably damaging Het
Add3 T C 19: 53,236,690 S414P probably benign Het
Ak3 C T 19: 29,037,871 probably null Het
Atg14 T C 14: 47,554,574 E132G possibly damaging Het
Bcl2l11 A G 2: 128,147,106 E135G probably benign Het
Brwd1 G A 16: 96,002,671 Q2100* probably null Het
Card11 A C 5: 140,908,604 V90G possibly damaging Het
Celsr3 T C 9: 108,832,308 V1451A probably benign Het
Clip4 T C 17: 71,806,728 I291T probably damaging Het
Clk1 C T 1: 58,419,677 D179N probably damaging Het
Cyp11b2 A G 15: 74,851,453 L454P probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Ep400 A G 5: 110,735,580 S663P unknown Het
Erich6 G A 3: 58,629,879 T238I possibly damaging Het
Herc1 T A 9: 66,372,207 H132Q probably benign Het
Hk2 A G 6: 82,730,877 C704R probably damaging Het
Ift74 A T 4: 94,686,904 R531W possibly damaging Het
Ism2 T C 12: 87,287,058 E71G probably benign Het
Lipe A C 7: 25,395,546 S22A probably benign Het
Myl10 A G 5: 136,694,293 D32G probably benign Het
Nomo1 A G 7: 46,044,281 H179R probably damaging Het
Olfr133 T C 17: 38,149,503 F305S probably benign Het
Olfr1378 T C 11: 50,969,552 F178S probably damaging Het
Pdpn T A 4: 143,270,538 T129S probably damaging Het
Pold1 C T 7: 44,542,158 V135I possibly damaging Het
Rasgrp3 T A 17: 75,500,139 N199K probably damaging Het
Skil T C 3: 31,113,565 S449P probably damaging Het
Spag16 T C 1: 69,853,381 L107P probably damaging Het
Tbccd1 A G 16: 22,822,337 M430T probably damaging Het
Tnfaip3 G A 10: 19,011,574 L68F probably damaging Het
Trrap G A 5: 144,796,971 R878H probably benign Het
Vasn T C 16: 4,649,616 S476P probably damaging Het
Vmn2r110 T A 17: 20,582,117 M499L probably benign Het
Zfp608 C A 18: 54,898,024 G948V probably damaging Het
Zswim5 A G 4: 116,984,778 I852V probably benign Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7947:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R8006:Wwp1 UTSW 4 19650174 missense probably benign
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGTATATGAATGGTTTGCCTCC -3'
(R):5'- TTAGGTGGAAGCTTGCTCAC -3'

Sequencing Primer
(F):5'- TCCGGCCCACATAACAGTTTC -3'
(R):5'- GTGGAAGCTTGCTCACTTCCG -3'
Posted On2019-06-07