Incidental Mutation 'PIT4243001:Ism2'
ID554468
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4243001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87287058 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 71 (E71G)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
Predicted Effect probably benign
Transcript: ENSMUST00000051601
AA Change: E27G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: E27G

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125733
AA Change: E71G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: E71G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 85.2%
  • 20x: 74.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,140 E252V possibly damaging Het
Abhd13 T C 8: 9,987,967 F188S possibly damaging Het
Abtb1 A G 6: 88,838,726 V225A probably benign Het
Accs A G 2: 93,841,334 M237T probably benign Het
Adcy9 A G 16: 4,418,407 I380T probably damaging Het
Add3 T C 19: 53,236,690 S414P probably benign Het
Ak3 C T 19: 29,037,871 probably null Het
Atg14 T C 14: 47,554,574 E132G possibly damaging Het
Bcl2l11 A G 2: 128,147,106 E135G probably benign Het
Brwd1 G A 16: 96,002,671 Q2100* probably null Het
Card11 A C 5: 140,908,604 V90G possibly damaging Het
Celsr3 T C 9: 108,832,308 V1451A probably benign Het
Clip4 T C 17: 71,806,728 I291T probably damaging Het
Clk1 C T 1: 58,419,677 D179N probably damaging Het
Cyp11b2 A G 15: 74,851,453 L454P probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Ep400 A G 5: 110,735,580 S663P unknown Het
Erich6 G A 3: 58,629,879 T238I possibly damaging Het
Herc1 T A 9: 66,372,207 H132Q probably benign Het
Hk2 A G 6: 82,730,877 C704R probably damaging Het
Ift74 A T 4: 94,686,904 R531W possibly damaging Het
Lipe A C 7: 25,395,546 S22A probably benign Het
Myl10 A G 5: 136,694,293 D32G probably benign Het
Nomo1 A G 7: 46,044,281 H179R probably damaging Het
Olfr133 T C 17: 38,149,503 F305S probably benign Het
Olfr1378 T C 11: 50,969,552 F178S probably damaging Het
Pdpn T A 4: 143,270,538 T129S probably damaging Het
Pold1 C T 7: 44,542,158 V135I possibly damaging Het
Rasgrp3 T A 17: 75,500,139 N199K probably damaging Het
Skil T C 3: 31,113,565 S449P probably damaging Het
Spag16 T C 1: 69,853,381 L107P probably damaging Het
Tbccd1 A G 16: 22,822,337 M430T probably damaging Het
Tnfaip3 G A 10: 19,011,574 L68F probably damaging Het
Trrap G A 5: 144,796,971 R878H probably benign Het
Vasn T C 16: 4,649,616 S476P probably damaging Het
Vmn2r110 T A 17: 20,582,117 M499L probably benign Het
Wwp1 T C 4: 19,638,631 T571A probably damaging Het
Zfp608 C A 18: 54,898,024 G948V probably damaging Het
Zswim5 A G 4: 116,984,778 I852V probably benign Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
canal UTSW 12 87280061 missense probably damaging 1.00
panamin UTSW 12 87286884 splice site probably null
Zone UTSW 12 87299663 missense unknown
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
R7973:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTTAGGCTCAGTTGC -3'
(R):5'- AACATGTGCTCCAGGTGCTC -3'

Sequencing Primer
(F):5'- GAGGTTCCCCTAGGCAAACAATG -3'
(R):5'- TCCAGGTGCTCACAGTCACAG -3'
Posted On2019-06-07