Incidental Mutation 'PIT4260001:Pkhd1'
ID 554482
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # PIT4260001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 20128003-20688288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20293130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2830 (V2830A)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088448
AA Change: V2830A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: V2830A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 38,129,948 (GRCm39) L71Q probably benign Het
Atp10a A T 7: 58,440,866 (GRCm39) K504* probably null Het
AW551984 T C 9: 39,504,275 (GRCm39) T564A probably benign Het
Cep128 A G 12: 91,265,808 (GRCm39) V268A probably benign Het
Clgn T C 8: 84,149,753 (GRCm39) M418T probably damaging Het
Col12a1 A G 9: 79,558,662 (GRCm39) probably null Het
Col4a3 A T 1: 82,660,482 (GRCm39) E933D unknown Het
Csmd1 A T 8: 16,120,327 (GRCm39) L1826Q probably damaging Het
Enpp2 C T 15: 54,707,774 (GRCm39) probably null Het
Ep400 G A 5: 110,841,037 (GRCm39) R1832* probably null Het
Exoc5 T C 14: 49,286,222 (GRCm39) K135R probably benign Het
Fam83h A G 15: 75,873,746 (GRCm39) F1197S probably damaging Het
Gabrg1 T C 5: 70,939,623 (GRCm39) I170V probably benign Het
Gigyf2 C T 1: 87,346,828 (GRCm39) R610C unknown Het
Gm16440 T C 14: 17,575,339 (GRCm39) E119G probably benign Het
Gm17669 A G 18: 67,695,508 (GRCm39) R18G probably damaging Het
Gxylt1 A G 15: 93,159,708 (GRCm39) S100P probably damaging Het
H3c10 C A 13: 21,902,089 (GRCm39) S87R possibly damaging Het
Hacd4 C G 4: 88,316,342 (GRCm39) R259T unknown Het
Hacd4 T A 4: 88,316,343 (GRCm39) R259* probably null Het
Hivep3 T C 4: 119,956,379 (GRCm39) L1565P probably damaging Het
Iqsec1 T A 6: 90,667,471 (GRCm39) D218V probably damaging Het
Matn2 C T 15: 34,428,877 (GRCm39) T747I possibly damaging Het
Myl6b T A 10: 128,332,175 (GRCm39) Q97L possibly damaging Het
Or5d18 A T 2: 87,865,126 (GRCm39) M119K probably damaging Het
Pcdh1 A G 18: 38,336,419 (GRCm39) V72A probably damaging Het
Pira2 T C 7: 3,845,173 (GRCm39) T362A probably benign Het
Pira2 C T 7: 3,845,169 (GRCm39) S363N probably benign Het
Pira2 G C 7: 3,845,172 (GRCm39) T362S probably benign Het
Plpp1 A G 13: 112,993,419 (GRCm39) D118G probably damaging Het
Polr2a A G 11: 69,626,793 (GRCm39) S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 (GRCm39) Q281K possibly damaging Het
Prl7a2 A T 13: 27,843,259 (GRCm39) Y181* probably null Het
Prpf4b T A 13: 35,068,274 (GRCm39) S368T probably benign Het
Prss45 A G 9: 110,667,513 (GRCm39) D53G probably benign Het
Ryr2 T A 13: 11,609,641 (GRCm39) H4395L possibly damaging Het
Spp2 G T 1: 88,338,927 (GRCm39) A97S probably benign Het
Strn4 T C 7: 16,556,434 (GRCm39) F99S probably damaging Het
Tcaf2 T A 6: 42,619,739 (GRCm39) H96L probably damaging Het
Tenm2 T C 11: 36,054,557 (GRCm39) D601G probably damaging Het
Trpm6 A T 19: 18,803,166 (GRCm39) M870L possibly damaging Het
Ttn T C 2: 76,773,569 (GRCm39) T2351A unknown Het
Xirp2 T A 2: 67,341,941 (GRCm39) I1394K possibly damaging Het
Zfc3h1 G T 10: 115,226,794 (GRCm39) D284Y probably damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,637,098 (GRCm39) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,594,294 (GRCm39) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,151,408 (GRCm39) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,641,614 (GRCm39) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,187,971 (GRCm39) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,593,482 (GRCm39) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,279,400 (GRCm39) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,604,754 (GRCm39) splice site probably benign
IGL01313:Pkhd1 APN 1 20,271,248 (GRCm39) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,593,201 (GRCm39) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,619,939 (GRCm39) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,269,683 (GRCm39) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,629,643 (GRCm39) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,187,203 (GRCm39) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,604,857 (GRCm39) nonsense probably null
IGL01790:Pkhd1 APN 1 20,628,895 (GRCm39) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,429,134 (GRCm39) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,173,459 (GRCm39) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,290,307 (GRCm39) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,268,361 (GRCm39) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,593,791 (GRCm39) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,592,971 (GRCm39) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,271,451 (GRCm39) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,447,623 (GRCm39) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,187,419 (GRCm39) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,345,839 (GRCm39) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,654,325 (GRCm39) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,279,484 (GRCm39) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,140,600 (GRCm39) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,271,007 (GRCm39) missense probably benign
IGL02389:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,269,710 (GRCm39) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,632,642 (GRCm39) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,484,645 (GRCm39) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,592,983 (GRCm39) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,434,425 (GRCm39) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,462,389 (GRCm39) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,143,731 (GRCm39) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,380,934 (GRCm39) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,590,480 (GRCm39) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,621,126 (GRCm39) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,628,976 (GRCm39) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,290,253 (GRCm39) splice site probably benign
IGL02752:Pkhd1 APN 1 20,623,815 (GRCm39) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,431,235 (GRCm39) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,678,640 (GRCm39) nonsense probably null
IGL02960:Pkhd1 APN 1 20,447,670 (GRCm39) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,593,187 (GRCm39) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,592,923 (GRCm39) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,635,857 (GRCm39) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,268,395 (GRCm39) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,271,243 (GRCm39) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,151,524 (GRCm39) splice site probably benign
IGL03375:Pkhd1 APN 1 20,187,247 (GRCm39) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,270,894 (GRCm39) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,593,118 (GRCm39) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,607,589 (GRCm39) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,681,638 (GRCm39) intron probably benign
P0035:Pkhd1 UTSW 1 20,187,571 (GRCm39) missense probably benign 0.00
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0115:Pkhd1 UTSW 1 20,420,714 (GRCm39) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,429,141 (GRCm39) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,610,624 (GRCm39) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,620,046 (GRCm39) splice site probably null
R0323:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,451,771 (GRCm39) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,188,012 (GRCm39) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,629,693 (GRCm39) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,380,738 (GRCm39) splice site probably benign
R0550:Pkhd1 UTSW 1 20,417,447 (GRCm39) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,309,660 (GRCm39) nonsense probably null
R0586:Pkhd1 UTSW 1 20,594,335 (GRCm39) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,271,114 (GRCm39) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,187,397 (GRCm39) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,187,698 (GRCm39) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,594,454 (GRCm39) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,268,331 (GRCm39) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,187,708 (GRCm39) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,420,745 (GRCm39) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,269,605 (GRCm39) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,271,483 (GRCm39) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,187,950 (GRCm39) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,593,053 (GRCm39) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,637,680 (GRCm39) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,641,629 (GRCm39) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,625,447 (GRCm39) splice site probably benign
R1411:Pkhd1 UTSW 1 20,444,120 (GRCm39) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,604,782 (GRCm39) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,593,207 (GRCm39) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,187,625 (GRCm39) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,417,664 (GRCm39) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,188,049 (GRCm39) missense probably benign
R1617:Pkhd1 UTSW 1 20,268,274 (GRCm39) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,593,121 (GRCm39) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,654,353 (GRCm39) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,621,064 (GRCm39) splice site probably benign
R1753:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,635,935 (GRCm39) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,655,376 (GRCm39) splice site probably benign
R1822:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,187,293 (GRCm39) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,685,491 (GRCm39) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,636,980 (GRCm39) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,151,524 (GRCm39) splice site probably benign
R1969:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,187,284 (GRCm39) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,269,683 (GRCm39) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,270,893 (GRCm39) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,683,036 (GRCm39) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,271,559 (GRCm39) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,623,798 (GRCm39) nonsense probably null
R2142:Pkhd1 UTSW 1 20,594,119 (GRCm39) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,484,444 (GRCm39) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,623,741 (GRCm39) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,607,584 (GRCm39) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,635,863 (GRCm39) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,604,759 (GRCm39) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,271,073 (GRCm39) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,271,079 (GRCm39) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,271,389 (GRCm39) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,279,406 (GRCm39) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,293,185 (GRCm39) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,174,823 (GRCm39) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,625,353 (GRCm39) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,655,879 (GRCm39) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,128,524 (GRCm39) makesense probably null
R3838:Pkhd1 UTSW 1 20,604,853 (GRCm39) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,628,947 (GRCm39) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,271,151 (GRCm39) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,382,362 (GRCm39) nonsense probably null
R3926:Pkhd1 UTSW 1 20,621,097 (GRCm39) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,633,910 (GRCm39) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,279,501 (GRCm39) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,664,158 (GRCm39) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,128,608 (GRCm39) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,128,841 (GRCm39) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,484,516 (GRCm39) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,309,635 (GRCm39) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,593,538 (GRCm39) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,282,082 (GRCm39) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,604,943 (GRCm39) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,683,633 (GRCm39) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,271,092 (GRCm39) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,573,280 (GRCm39) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,434,391 (GRCm39) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,151,452 (GRCm39) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,594,354 (GRCm39) missense probably benign
R4750:Pkhd1 UTSW 1 20,594,336 (GRCm39) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,269,639 (GRCm39) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,607,625 (GRCm39) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,140,712 (GRCm39) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,279,450 (GRCm39) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,358,429 (GRCm39) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,655,935 (GRCm39) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,655,415 (GRCm39) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,279,448 (GRCm39) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,617,565 (GRCm39) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,345,865 (GRCm39) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,604,769 (GRCm39) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,420,635 (GRCm39) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,636,094 (GRCm39) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,520,528 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,593,658 (GRCm39) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,462,321 (GRCm39) missense probably benign
R5431:Pkhd1 UTSW 1 20,188,060 (GRCm39) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,309,609 (GRCm39) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,271,380 (GRCm39) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,447,628 (GRCm39) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,151,476 (GRCm39) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,593,366 (GRCm39) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,143,750 (GRCm39) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,628,850 (GRCm39) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,658,755 (GRCm39) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,617,685 (GRCm39) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,593,875 (GRCm39) nonsense probably null
R5760:Pkhd1 UTSW 1 20,143,778 (GRCm39) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,279,409 (GRCm39) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,128,824 (GRCm39) missense probably benign
R5810:Pkhd1 UTSW 1 20,270,897 (GRCm39) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,269,629 (GRCm39) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,128,902 (GRCm39) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,271,307 (GRCm39) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,451,685 (GRCm39) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,444,960 (GRCm39) nonsense probably null
R5852:Pkhd1 UTSW 1 20,447,632 (GRCm39) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,590,434 (GRCm39) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,593,994 (GRCm39) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,282,175 (GRCm39) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,655,927 (GRCm39) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,271,047 (GRCm39) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,682,929 (GRCm39) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,128,563 (GRCm39) missense probably benign
R6886:Pkhd1 UTSW 1 20,417,504 (GRCm39) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,593,739 (GRCm39) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,604,925 (GRCm39) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,632,675 (GRCm39) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,628,943 (GRCm39) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,593,350 (GRCm39) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,617,743 (GRCm39) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,664,177 (GRCm39) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,271,197 (GRCm39) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,309,528 (GRCm39) missense not run
R7436:Pkhd1 UTSW 1 20,270,925 (GRCm39) missense probably benign
R7473:Pkhd1 UTSW 1 20,619,980 (GRCm39) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,417,585 (GRCm39) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,271,149 (GRCm39) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,617,717 (GRCm39) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,632,639 (GRCm39) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,573,223 (GRCm39) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,382,273 (GRCm39) missense probably benign
R7920:Pkhd1 UTSW 1 20,345,759 (GRCm39) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,579,115 (GRCm39) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,451,662 (GRCm39) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,683,639 (GRCm39) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,593,313 (GRCm39) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,632,682 (GRCm39) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,607,644 (GRCm39) splice site probably benign
R8485:Pkhd1 UTSW 1 20,593,257 (GRCm39) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,590,432 (GRCm39) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,593,199 (GRCm39) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,462,374 (GRCm39) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,358,461 (GRCm39) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,143,679 (GRCm39) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,187,785 (GRCm39) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,462,234 (GRCm39) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,417,529 (GRCm39) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,434,425 (GRCm39) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,592,975 (GRCm39) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,573,176 (GRCm39) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,632,586 (GRCm39) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,604,799 (GRCm39) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,444,174 (GRCm39) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,618,351 (GRCm39) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,293,118 (GRCm39) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,682,953 (GRCm39) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,637,741 (GRCm39) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,269,570 (GRCm39) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,462,437 (GRCm39) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,617,690 (GRCm39) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,420,708 (GRCm39) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,484,636 (GRCm39) missense probably benign
R9781:Pkhd1 UTSW 1 20,187,665 (GRCm39) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,637,073 (GRCm39) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,444,150 (GRCm39) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,590,450 (GRCm39) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,593,971 (GRCm39) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,593,845 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,380,818 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,188,107 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,621,243 (GRCm39) missense probably benign
Z1177:Pkhd1 UTSW 1 20,594,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATAAATGGAACTCCTCTGC -3'
(R):5'- ACACAGCCTTCTTCAGAGAGTG -3'

Sequencing Primer
(F):5'- GATAAATGGAACTCCTCTGCCTCTC -3'
(R):5'- ACCTTGTTTATGTGACCAGTGAC -3'
Posted On 2019-06-07